Arboridia kakogawana

(Matsumura, 1932) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Arboridia

At a glance

Occurrence records52

Data sources5

Biological traits0

DNA specimens11

eDNA detections17

Sources5 archives

Databases and archives Arboridia kakogawana's data was compiled from.

GBIFGlobal Biodiversity Information Facility52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF52 records

Environmental DNA1 datasets · 4 countries17 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arboridia kakogawana has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections17

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

8Amostly conserved

9Cmostly conserved

10Tmostly conserved

12Tmostly conserved

21Gmostly conserved

58Amostly conserved

60Tmostly conserved

81Gmostly conserved

120Gmostly conserved

186Tmostly conserved

189Tmostly conserved

195Amostly conserved

196Cmostly conserved

213Tmostly conserved

225Cmostly conserved

234Cmostly conserved

270Tmostly conserved

317Cmostly conserved

330Amostly conserved

480Tmostly conserved

618Amostly conserved

ACTATATACTTTATTTTTGGGATTTGAGCAGGTATAGTAGGAATAATACTAAGAATAATTATCCGGATTGAATTAGCTCAGCCTGGAGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes9

BIN1

Most divergent pair2.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eratoneura flexibilissame family11.9%Arboridia pusillasame genus11.9%Illinigina illinoiensissame family12.0%Arboridia parvulasame genus12.5%Erythroneura vitifexsame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type52 records

Wild obs. + sensor27

Museum / vouchered25

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 10≤10 km 14

24 georeferenced · 3 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 13

13 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	25

1 institutions · 25 of 25 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Arboridia kakogawana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

1. Forest & Woodland | 1.4. Temperate Forestvineyard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 7.90–19.3

Seasonal swing summer↔winter19.1 °C

Max temp (day)20.8 °C 12.1–22.0

Min temp (night)14.2 °C 2.10–15.6

Precipitation235 mm/mo 78.0–378

Air humidity65.2 % 59.2–68.7

Moisture balance144 mm/mo -24.9–287

Vapour deficit648 Pa 432–837

Wind speed1.60 m/s 1.40–2.70

Cloud cover28.9 % 28.5–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)