Arbacia stellata

Gmelin, 1872 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Arbacioida/Arbaciidae/Arbacia

At a glance

Occurrence records4 595

Data sources6

Biological traits1

DNA specimens47

eDNA detections48

Sources6 archives

Databases and archives Arbacia stellata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 497 records↗

OBISOcean Biodiversity Information System2 098 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS4 595 records

Environmental DNA1 datasets · 5 countries48 detections

DNA & barcodingBOLD47 specimens

01Narrative

Arbacia stellata is a species of sea urchin of the family Arbaciidae. Their armour is covered with spines. It is placed in the genus Arbacia and lives in the sea. Arbacia stellata was first scientifically described in 1825 by Blainville.Kroh, A. (2010). Arbacia stellata (Blainville, 1825). In: Kroh, A. & Mooi, R. (2010) World Echinoidea Database. at the World Register of Marine Species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arbacia stellata has left across the world's sequence archives.

At a glance

DNA specimens47

BINs1

Marker genes2

eDNA detections48

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

162Amostly conserved

309Amostly conserved

351Amostly conserved

579Tmostly conserved

GGGGCTTGAGCAGGCATGGTAGGAACAGCCATGAGAGTTATTATTCGAGCTGAGCTTGCCCAACCTGGCTCCCTACTTCAAGACGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes7

BIN1

Most divergent pair0.92%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arbacia dufresniisame genus8.7%Arbacia spatuligerasame genus9.7%Arbacia punctulatasame genus10.5%Arbacia lixulasame genus11.8%Arbaciella eleganssame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type4 595 records

Wild obs. + sensor4 225

Museum / vouchered368

Fossil2

Range

Area of Occupancy AOO1 288 km²

Depth

0–200 m sunlit2 032

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 9 m · max 219.5 m · 2 033 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 186≤1 km 3 955≤10 km 4>10 km 58

4 203 georeferenced · 22 without coordinates

Open the mapobservation + sensor4 225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 4≤1 km 28≤10 km 70>10 km 60

162 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence368

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	124
CASlocation not on record	52
Cambridge, US	39
Santa Barbara Museum of Natural Historylocation not on record	32
New Haven, US	2
Stockholm, SE	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1
UM-RSMASlocation not on record	1
Universidad del Valle (UniValle)location not on record	1

10 institutions · 255 of 368 vouchered records shown

09Environmental DNA48 detections

Where the DNA of Arbacia stellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.3 °C 24.2–25.7

Seasonal swing summer↔winter1.40 °C

Max temp (day)28.1 °C 27.2–29.2

Min temp (night)23.1 °C 19.8–24.7

Precipitation163 mm/mo 137–240

Air humidity68.4 % 61.0–68.6

Moisture balance7.90 mm/mo -1.50–76.3

Vapour deficit1,043 Pa 1,012–1,179

Wind speed4.30 m/s 0.8–5.00

Cloud cover30.7 % 30.5–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arbacia stellata

At a glance

Sources6 archives

Habitat & environment1

At a glance

Record type4 595 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 595 records