Arbacia punctulata

(Lamarck, 1816) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Arbacioida/Arbaciidae/Arbacia

At a glance

Occurrence records3 634

Data sources13

Biological traits5

DNA specimens64

eDNA detections64

Sources13 archives

Databases and archives Arbacia punctulata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 194 records↗

OBISOcean Biodiversity Information System1 440 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources5 traits

Chemical compositionLOTUS29 compounds

Occurrence & distributionGBIF · OBIS3 634 records

Environmental DNA1 datasets · 4 countries64 detections

DNA & barcodingBOLD64 specimens

Genome at a glanceGoaT743 Mbp

01Narrative

The Atlantic purple sea urchin (Arbacia punctulata) is a species of sea urchins from the family Arbaciidae, native to the Atlantic Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max225 m

Depth min0 m

03Chemical composition29 compounds

Compounds documented for Arbacia punctulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Unsaturated fatty acids26

Branched fatty acids $ Unsaturated fatty acids3

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(5Z,8Z,11Z,14Z,17Z)-eicosapentaenoate	present	LOTUS
11-Eicosenoic Acid	present	LOTUS
2-Hexadecenoic acid	present	LOTUS
2-Octadecenoic acid	present	LOTUS
2-Tetracosenoic acid	present	LOTUS
Eicosadienoic Acid	present	LOTUS
Eicosanic acid	present	LOTUS
Eicosapentenoic acid	present	LOTUS
Hexadecadienoic acid	present	LOTUS
Hexadecatetraenoic Acid	present	LOTUS

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arbacia punctulata has left across the world's sequence archives.

At a glance

DNA specimens64

BINs1

Marker genes3

eDNA detections64

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

27Gmostly conserved

63Gvariable

90Gmostly conserved

165Cmostly conserved

222Amostly conserved

268Cvariable

285Amostly conserved

297Amostly conserved

303Avariable

336Tmostly conserved

357Gmostly conserved

360Amostly conserved

384Gvariable

411Avariable

417Avariable

477Amostly conserved

489Gvariable

531Avariable

537Tmostly conserved

564Amostly conserved

609Gmostly conserved

612Avariable

GGAGCCTGAGCAGGCATGGTAGGAACGGCCATGAGAGTTATTATTCGAGCTGAACTCGCTCAGCCCGGTTCCCTACTCCAAGATGACCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes30

BIN1

Most divergent pair3.2%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arbacia lixulasame genus9.7%Arbacia spatuligerasame genus10.0%Arbacia stellatasame genus10.5%Arbaciella eleganssame family10.8%Arbacia dufresniisame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Arbacia punctulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size743 280 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arbacia punctulata0.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome records38–402n range39median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 401×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 634 records

Wild obs. + sensor1 081

Museum / vouchered2 513

Fossil40

Origin

Native25

Range

Area of Occupancy AOO4 820 km²

Depth

0–200 m sunlit1 116

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 20.5 m · max 307 m · 1 117 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 343≤1 km 93≤10 km 40>10 km 42

518 georeferenced · 563 without coordinates

Open the mapobservation + sensor1 081

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 38≤1 km 12≤10 km 324>10 km 51

425 georeferenced · 2 088 without coordinates

Open the institutions mapphysical evidence2 513

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	504
Cambridge, US	334
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	67
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	45
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	42
FCMMlocation not on record	40
New Haven, US	29
Texas Cooperative Wildlife Collectionlocation not on record	25
Los Angeles, US	18
CASlocation not on record	7
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	6
The University of the West Indies, Trinidad and Tobagolocation not on record	5
Santa Barbara Museum of Natural Historylocation not on record	4
UM-RSMASlocation not on record	3
Chicago, US	3
Toronto, CA	3
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Región Poza Rica-Tuxpanlocation not on record	2
Instituto de Ciencias del Mar y Limnologialocation not on record	2
Chicago, US	2
Universidad del Valle de Guatemalalocation not on record	1
Denver, US	1
Helsinki, FI	1
INVEMAR \| UNALlocation not on record	1
Auckland, NZ	1
Natural History Museum Rotterdamlocation not on record	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

27 institutions · 1 149 of 2 513 vouchered records shown · 395 without an institution code

09Environmental DNA64 detections

Where the DNA of Arbacia punctulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–24.4

Seasonal swing summer↔winter20.9 °C

Max temp (day)18.4 °C 18.4–27.5

Min temp (night)8.20 °C 8.20–21.3

Precipitation96.1 mm/mo 79.6–107

Air humidity57.3 % 57.3–67.1

Moisture balance-38.4 mm/mo -38.4–13.7

Vapour deficit733 Pa 727–1,072

Wind speed5.80 m/s 2.20–5.80

Cloud cover36.7 % 27.7–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arbacia punctulata

At a glance

Sources13 archives

Habitat & environment3

Other traits2

Compound class profile2 classes

Documented compounds29 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 634 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 634 records