Arbacia dufresnii

(Blainville, 1825) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Arbacioida/Arbaciidae/Arbacia

At a glance

Occurrence records10 511

Data sources9

Biological traits4

DNA specimens95

eDNA detections58

Sources9 archives

Databases and archives Arbacia dufresnii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 870 records↗

OBISOcean Biodiversity Information System641 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics95 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS10 511 records

Environmental DNA1 datasets · 2 countries58 detections

DNA & barcodingBOLD95 specimens

01Narrative

Arbacia crassispina is a species of sea urchin of the family Arbaciidae. Its armour is covered with spines. A. crassispina was first scientifically described in 1910 by Ole Theodor Jensen Mortensen.Kroh, A. (2010). Arbacia crassispina (Ole Theodor Jensen Mortensen, 1910). In: Kroh, A. & Mooi, R. (2010) World Echinoidea Database. at the World Register of Marine Species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max315 m

Depth min0 m

05DNA & barcoding95 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arbacia dufresnii has left across the world's sequence archives.

At a glance

DNA specimens95

BINs2

Marker genes2

eDNA detections58

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

171Tmostly conserved

244Tmostly conserved

364Gmostly conserved

388Tmostly conserved

477Gmostly conserved

516Tmostly conserved

651Cvariable

GGGGCTTGAGCAGGTATGGTAGGAACAGCCATGAGAGTTATTATTCGAGCTGAACTCGCTCAACCTGGCTCTCTACTTCAAGATGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes20

BINs2

Most divergent pair9.2%

EuropeS.AmericaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arbacia spatuligerasame genus6.3%Arbacia stellatasame genus8.7%Arbacia lixulasame genus10.1%Arbaciella eleganssame family10.3%Arbacia punctulatasame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type10 511 records

Wild obs. + sensor9 543

Museum / vouchered963

Other5

Range

Area of Occupancy AOO2 244 km²

Depth

0–200 m sunlit370

200–1000 m twilight9

1–4 km midnight0

>4 km abyssal0

median 11.5 m · max 400 m · 379 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 148≤1 km 73≤10 km 6 542>10 km 4

6 767 georeferenced · 2 776 without coordinates

Open the mapobservation + sensor9 543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 156≤1 km 27≤10 km 60>10 km 38

281 georeferenced · 682 without coordinates

Open the institutions mapphysical evidence963

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Nacional de Historia Natural de Chilelocation not on record	95
Buenos Aires, AR	62
UMAGlocation not on record	36
fcnym.unlp.edu.arlocation not on record	19
BASElocation not on record	18
South Kensington, GB	17
Cambridge, US	14
CASlocation not on record	13
Washington, US	13
Universidad Austral de Chilelocation not on record	12
Universidad Católica del Nortelocation not on record	10
Paris, FR	4
IBIOMARlocation not on record	3
Los Angeles, US	3
NTNU-VMlocation not on record	2
Stockholm, SE	2
Valparaiso, CL	2
Earth Sciences New Zealandlocation not on record	1
Chongqing Museumlocation not on record	1
University of Oslo (UiO)location not on record	1

20 institutions · 328 of 963 vouchered records shown · 252 without an institution code

09Environmental DNA58 detections

Where the DNA of Arbacia dufresnii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 14.1–15.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)21.8 °C 20.5–21.8

Min temp (night)11.5 °C 8.70–11.5

Precipitation66.4 mm/mo 66.4–145

Air humidity54.7 % 54.7–58.8

Moisture balance-49.9 mm/mo -49.9–39.0

Vapour deficit875 Pa 702–875

Wind speed3.80 m/s 2.50–3.80

Cloud cover27.2 % 20.8–27.2

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arbacia dufresnii

At a glance

Sources9 archives

Habitat & environment2

Other traits2

At a glance

Record type10 511 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 511 records