Arawacus sito

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arawacus

At a glance

Occurrence records3 445

Data sources5

Biological traits0

DNA specimens11

eDNA detections2

Sources5 archives

Databases and archives Arawacus sito's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 445 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 445 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD11 specimens

01Narrative

Arawacus sito, the fine-lined stripe-streak, is a butterfly of the family Lycaenidae. It is in found from Mexico, south to Central America, including Guatemala, Honduras, Nicaragua and Panama

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arawacus sito has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

38Cmostly conserved

112Cmostly conserved

127Amostly conserved

206Tmostly conserved

349Cvariable

470Amostly conserved

547Gmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACATCATTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arawacus leucogynasame genus1.7%Arawacus lincoidessame genus3.6%Deudorix antalussame family4.4%Strephonota tyriamsame family4.7%Arawacus separatasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 445 records

Wild obs. + sensor382

Museum / vouchered2 283

Other780

Range

Area of Occupancy AOO2 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 136≤1 km 101≤10 km 40>10 km 11

288 georeferenced · 94 without coordinates

Open the mapobservation + sensor382

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 1 097≤1 km 42≤10 km 15>10 km 3

1 157 georeferenced · 1 126 without coordinates

Open the institutions mapphysical evidence2 283

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	1 438
Ciudad de México, MX	399
Tapachula, MX	279
Washington, US	34
Ciudad de México, MX	22
Cambridge, US	18
Chongqing Museumlocation not on record	12
Uniwersytet Jagiellońskilocation not on record	9
Universidad del Valle de Guatemalalocation not on record	8
New Haven, US	6
Los Angeles, US	6
National Biodiversity Institute, Costa Ricalocation not on record	5
Smithsonian Institutionlocation not on record	2
Zürich, CH	1
Tuxtla Gutiérrez, MX	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Georgia Museum of Natural Historylocation not on record	1
Brussels, BE	1

18 institutions · 2 243 of 2 283 vouchered records shown · 40 without an institution code

09Environmental DNA2 detections

Where the DNA of Arawacus sito was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.8–25.4

Seasonal swing summer↔winter2.70 °C

Max temp (day)27.7 °C 26.9–28.5

Min temp (night)22.8 °C 22.4–23.1

Precipitation83.4 mm/mo 45.6–121

Air humidity65.2 % 65.0–65.5

Moisture balance-49.1 mm/mo -95.3–-2.90

Vapour deficit1,107 Pa 1,079–1,134

Wind speed3.40 m/s 1.90–4.90

Cloud cover27.0 % 23.1–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arawacus sito

At a glance

Sources5 archives

At a glance

Record type3 445 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 445 records