Arawacus separata

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arawacus

At a glance

Occurrence records778

Data sources5

Biological traits0

DNA specimens15

eDNA detections15

Sources5 archives

Databases and archives Arawacus separata's data was compiled from.

GBIFGlobal Biodiversity Information Facility778 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF778 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arawacus separata has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

100Avariable

115Cvariable

118Tmostly conserved

160Gmostly conserved

181Amostly conserved

197Tmostly conserved

202Cmostly conserved

220Tmostly conserved

250Cmostly conserved

271Cmostly conserved

287Cvariable

553Gmostly conserved

562Avariable

604Tmostly conserved

628Cvariable

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACCCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.77%

Haplotypes8

BIN1

Most divergent pair1.8%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arawacus togarnasame genus3.0%Arawacus lincoidessame genus3.0%Callophrys fotissame family5.0%Callophrys poliossame family5.0%Arawacus leucogynasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type778 records

Wild obs. + sensor729

Museum / vouchered49

Origin

Native3

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 261≤1 km 239≤10 km 54>10 km 28

582 georeferenced · 147 without coordinates

Open the mapobservation + sensor729

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 10

16 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	13
Uniwersytet Jagiellońskilocation not on record	12
UNICAMPlocation not on record	11
Auckland, NZ	3
Zürich, CH	2

5 institutions · 41 of 49 vouchered records shown · 8 without an institution code

09Environmental DNA15 detections

Where the DNA of Arawacus separata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 13.7–24.2

Seasonal swing summer↔winter5.80 °C

Max temp (day)26.2 °C 17.4–28.8

Min temp (night)18.5 °C 9.60–20.0

Precipitation181 mm/mo 172–309

Air humidity63.2 % 62.4–67.4

Moisture balance76.1 mm/mo 40.6–172

Vapour deficit978 Pa 509–1,135

Wind speed1.40 m/s 0.7–1.80

Cloud cover42.5 % 26.9–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)