Arawacus lincoides

(Draudt, 1917) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Arawacus

At a glance

Occurrence records823

Data sources5

Biological traits0

DNA specimens18

eDNA detections20

Sources5 archives

Databases and archives Arawacus lincoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility823 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF823 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD18 specimens

01Narrative

Arawacus lincoides est une espèce d'insectes lépidoptères de la famille des Lycaenidae, sous-famille des Theclinae et du genre Arawacus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arawacus lincoides has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections20

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

14Amostly conserved

15Tmostly conserved

20Gmostly conserved

22Amostly conserved

24Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

34Amostly conserved

61Amostly conserved

100Amostly conserved

235Tmostly conserved

268Amostly conserved

284Tmostly conserved

289Amostly conserved

313Tmostly conserved

322Amostly conserved

364Tmostly conserved

368Gmostly conserved

421Cmostly conserved

466Amostly conserved

470Amostly conserved

538Gvariable

550Amostly conserved

562Amostly conserved

628Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes8

BIN1

Most divergent pair0.76%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arawacus togarnasame genus2.3%Arawacus separatasame genus3.0%Paraspiculatus grandesame family3.8%Strephonota tyriamsame family3.8%Siderus nouraguensissame family4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type823 records

Wild obs. + sensor678

Museum / vouchered145

Origin

Native5

Range

Area of Occupancy AOO1 804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 236≤1 km 192≤10 km 91>10 km 23

542 georeferenced · 136 without coordinates

Open the mapobservation + sensor678

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤1 km 2≤10 km 5

10 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Uniwersytet Jagiellońskilocation not on record	100
National Biodiversity Institute, Costa Ricalocation not on record	20
Universidad Nacional de Colombia (UNAL)location not on record	5
ASUlocation not on record	4
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
University of Memphislocation not on record	1

6 institutions · 134 of 145 vouchered records shown · 11 without an institution code

09Environmental DNA20 detections

Where the DNA of Arawacus lincoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 20.3–26.4

Seasonal swing summer↔winter1.00 °C

Max temp (day)28.1 °C 23.9–29.6

Min temp (night)22.2 °C 16.0–23.8

Precipitation199 mm/mo 63.3–365

Air humidity65.4 % 62.2–70.9

Moisture balance77.9 mm/mo -90.2–415

Vapour deficit1,008 Pa 815–1,286

Wind speed1.20 m/s 1.00–3.90

Cloud cover32.9 % 11.7–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)