Aratinga solstitialis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Aratinga

At a glance

Occurrence records161

Data sources13

Biological traits26

DNA specimens5

eDNA detections5

Sources13 archives

Databases and archives Aratinga solstitialis's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF161 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT · NCBI1.3 Gbp

01Narrative

The sun parakeet (Aratinga solstitialis), also known in aviculture as the sun conure, is a medium-sized, vibrantly colored parrot native to northeastern South America. The adult male and female are similar in appearance, with predominantly golden-yellow plumage and orange-flushed underparts and face. Sun parakeets are very social birds, typically living in flocks. They form monogamous pairs for reproduction, and nest in palm cavities in the tropics. Sun parakeets mainly feed on fruits, flowers, berries, blossoms, seeds, nuts, and insects. Conures are commonly bred and kept in aviculture and may live up to 30 years. This species is currently threatened by loss of habitat and trapping for plumage or the pet trade. Sun parakeets are now listed as endangered by the IUCN (International Union for Conservation of Nature).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAmnioteDBAVONET

Size & morphology11

Beak depth24.8 mm

Beak length (culmen)28.2 mm

Beak length (nares)22.8 mm

Beak width12.8 mm

Body mass111 g

⚠ sources differ — AmnioteDB: 111 g · AVONET: 120 g · EltonTraits: 120 g

Hand-wing index41.3

Kipp's distance64.7 mm

Secondary length91.6 mm

Tail length138 mm

Tarsus length14.8 mm

Wing length156 mm

Life cycle & reproduction5

Egg mass8.74 g

Fledging age56 days

Incubation27.5 days

Litter size4

Neonate mass6.02 g

Diet & foraging6

Canopy20 %

Fruit100 %

Midhigh60 %

Trophic levelherbivore

Trophic nicheFrugivore

Understory20 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size96 378 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aratinga solstitialis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

94Amostly conserved

385Amostly conserved

CCTCTACCTAATCTTCGGTGCATGAGCAGGTATAGTCGGCACTGCCTTAAGCCTACTCATTCGTGCAGAACTAGGTCAACCGGGGACCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.31%

OtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ara araraunasame family8.7%Ara macaosame family9.3%Ara ambiguussame family9.4%Ara severussame family9.5%Cyanoliseus patagonussame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_026039 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aratinga solstitialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 339 860 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aratinga solstitialis1.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Chromosome records70–702n range70median70mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 703×GoaT · Animal Chromosome Counts Database · GoaT · Bird Chromosome Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type161 records

Wild obs. + sensor116

Museum / vouchered45

Origin

Native1

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤100 m 3≤1 km 2≤10 km 4>10 km 105

114 georeferenced · 2 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 5≤10 km 8>10 km 1

14 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	24
Chicago, US	7
Seattle, US	3
Philadelphia, US	2
US	2
München, DE	2
ASNHClocation not on record	1
Cambridge, US	1
University, National Zoological Collection of Surinamelocation not on record	1
Musée des Confluenceslocation not on record	1
Toronto, CA	1

11 institutions · 45 of 45 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Aratinga solstitialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)