Ara severus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Ara

At a glance

Occurrence records131 484

Data sources11

Biological traits29

DNA specimens27

eDNA detections22

Sources11 archives

Databases and archives Ara severus's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 484 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF131 484 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceGoaT · NCBI1.3 Gbp

01Narrative

The chestnut-fronted macaw or severe macaw (Ara severus) is one of the largest of the mini-macaws. It reaches a size of around 45 cm of which around half is the length of the tail. They can be found over a large part of Northern South America from Panama south into Amazonian Brazil and central Bolivia. A feral population is found in Florida. Their lifespan is listed as anything from 30 to 80 years of age.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAnAgeAVONET

Size & morphology14

Beak depth36.9 mm

Beak length (culmen)39.7 mm

Beak length (nares)36.1 mm

Beak width20.5 mm

Body mass343 g

Body mass (female)336 g

Body mass (male)371 g

Hand-wing index35.9

Kipp's distance86.3 mm

SVL44.5 cm

Secondary length153 mm

Tail length243 mm

Tarsus length20.7 mm

Wing length239 mm

Life cycle & reproduction4

Egg mass21 g

Incubation28 days

Litter size2

Max. longevity342 months

Diet & foraging7

Canopy40 %

Fruit30 %

Midhigh60 %

Plant other20 %

Seed50 %

Trophic levelherbivore

Trophic nicheOmnivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size5 824 493 km²

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ara severus has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes2

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

375Amostly conserved

435Tmostly conserved

471Cmostly conserved

570Cmostly conserved

606Gmostly conserved

ACTGCCCTAAGTCTACTCATCCGTGCAGAGCTCGGCCAACCAGGGACTCTCCTGGGGGACGACCAGATCTATAATGTAATTGTCACAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes5

BINs2

Most divergent pair5.2%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ara araraunasame genus6.4%Ara ambiguussame genus7.2%Ara macaosame genus7.4%Ara chloropterussame genus8.0%Enicognathus leptorhynchussame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ara severus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 310 520 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ara severus1.31 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type131 484 records

Wild obs. + sensor131 387

Museum / vouchered97

Origin

Native64

Range

Area of Occupancy AOO44 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 354≤1 km 127≤10 km 35>10 km 1 549

2 065 georeferenced · 129 322 without coordinates

Open the mapobservation + sensor131 387

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 3≤10 km 15>10 km 3

22 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	16
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	10
Louisiana State University, Museum of Zoologylocation not on record	10
Washington, US	9
Berkeley, US	6
Buenos Aires, AR	4
Universidad de Caldas (UCaldas)location not on record	4
Geneva, CH	4
Area metropolitana del Valle de Aburralocation not on record	4
Ann Arbor, US	4
Universidad Industrial de Santander (UIS)location not on record	3
Chicago, US	3
Barcelona, ES	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
US	2
Moore Laboratory of Zoology, Occidental Collegelocation not on record	1
Corporacion Autonoma Regional del Valle del Caucalocation not on record	1
Museo de Historia Natural “Gustavo Orcés V"location not on record	1
Tilburg, NL	1
Musée des Confluenceslocation not on record	1
Universidad del Valle (UniValle)location not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
University, National Zoological Collection of Surinamelocation not on record	1
University of Nebraska State Museumlocation not on record	1
	1
Seattle, US	1

26 institutions · 94 of 97 vouchered records shown · 3 without an institution code

09Environmental DNA22 detections

Where the DNA of Ara severus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 14.5–25.3

Seasonal swing summer↔winter0.7 °C

Max temp (day)24.4 °C 18.8–28.9

Min temp (night)17.7 °C 10.0–21.8

Precipitation201 mm/mo 130–218

Air humidity65.7 % 59.8–67.1

Moisture balance96.0 mm/mo 20.8–113

Vapour deficit900 Pa 550–1,294

Wind speed1.90 m/s 1.10–1.90

Cloud cover37.0 % 33.0–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ara severus

At a glance

Sources11 archives

Size & morphology14

Life cycle & reproduction4

Diet & foraging7

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type131 484 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type131 484 records