Ara chloropterus

G.R.Gray, 1859 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Ara

At a glance

Occurrence records44 557

Data sources12

Biological traits31

DNA specimens16

eDNA detections16

Sources12 archives

Databases and archives Ara chloropterus's data was compiled from.

WikipediaWikimedia Foundation17 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 557 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF44 557 records

Environmental DNA1 datasets · 3 countries16 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI1.4 Gbp

01Narrative

The red-and-green macaw (Ara chloropterus), also known as the green-winged macaw, is a large, mostly-red macaw of the genus Ara. This is the largest of the genus Ara, widespread in the forests and woodlands of northern and central South America. However, in common with other macaws, in recent years there has been a marked decline in its numbers due to habitat loss and illegal capture for the parrot trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAnAgeAVONET

Size & morphology13

Beak depth75.1 mm

Beak length (culmen)76.7 mm

Beak length (nares)74.6 mm

Beak width35.2 mm

Body mass1 220 g

Body mass (male)1 050 g

Hand-wing index41.5

Kipp's distance167 mm

SVL84 cm

Secondary length236 mm

Tail length486 mm

Tarsus length34.3 mm

Wing length402 mm

Life cycle & reproduction7

Egg mass34 g

Fledging age103 days

Gestation28 days

Growth rate0.112 /day

Incubation35 days

Litter size2.5

Max. longevity601 months

Diet & foraging7

Canopy40 %

Fruit40 %

Midhigh60 %

Plant other30 %

Seed30 %

Trophic levelherbivore

Trophic nicheOmnivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size8 101 232 km²

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ara chloropterus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes2

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P678 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.31%

Haplotypes2

BIN1

Most divergent pair0.29%

Where individuals differ — all 10 variable positions, in barcode order

39Gmostly conserved

69Amostly conserved

252Cmostly conserved

285Gmostly conserved

315Gmostly conserved

357Amostly conserved

414Gvariable

459Amostly conserved

514Tmostly conserved

570Cmostly conserved

GGCGCATGAGCAGGCATAGTTGGTACCGCCTTGAGCCTGCTCATCCGTGCAGAACTCGGTCAGCCAGGAACCCTTCTAGGAGACGACCAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ara ambiguussame genus3.4%Ara militarissame genus3.4%Ara macaosame genus3.6%Ara araraunasame genus6.9%Ara severussame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_047199 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ara chloropterus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 447 440 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ara chloropterus1.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Chromosome records68–702n range69median68mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 682×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

2n 702×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type44 557 records

Wild obs. + sensor44 410

Museum / vouchered147

Origin

Native74

Range

Area of Occupancy AOO29 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 348≤1 km 98≤10 km 57>10 km 1 432

1 935 georeferenced · 42 475 without coordinates

Open the mapobservation + sensor44 410

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 9≤10 km 19>10 km 11

42 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	33
Philadelphia, US	14
Louisiana State University, Museum of Zoologylocation not on record	12
Ann Arbor, US	9
Paris, FR	8
Washington, US	8
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	7
New Haven, US	5
Cambridge, US	4
Universidad Nacional de Colombia (UNAL)location not on record	4
Brussels, BE	4
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
RBINS-Scientific Heritagelocation not on record	3
Universidad de Caldas (UCaldas)location not on record	3
Instituto Tecnológico Metropolitanolocation not on record	3
INMAlocation not on record	2
Musée des Confluenceslocation not on record	2
Toronto, CA	2
South Kensington, GB	1
Museo de Historia Natural “Gustavo Orcés V"location not on record	1
Seattle, US	1
Barcelona, ES	1
Zografou, GR	1
UNICAMPlocation not on record	1
CASlocation not on record	1
Universidade Federal de Minas Geraislocation not on record	1
Honolulu, US	1
Berkeley, US	1

29 institutions · 140 of 147 vouchered records shown · 7 without an institution code

09Environmental DNA16 detections

Where the DNA of Ara chloropterus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 9.10–22.2

Seasonal swing summer↔winter21.9 °C

Max temp (day)23.2 °C 13.0–23.9

Min temp (night)16.5 °C 4.90–20.1

Precipitation241 mm/mo 35.2–261

Air humidity65.1 % 60.6–66.0

Moisture balance104 mm/mo

Vapour deficit878 Pa 630–906

Wind speed2.30 m/s

Cloud cover45.6 % 33.2–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ara chloropterus

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging7

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type44 557 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type44 557 records