Ara ambiguus

(Bechstein, 1811) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Ara

At a glance

Occurrence records1 374

Data sources11

Biological traits24

DNA specimens11

eDNA detections8

Sources11 archives

Databases and archives Ara ambiguus's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 374 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF1 374 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI1.3 Gbp

01Narrative

The great green macaw (Ara ambiguus), also known as Buffon's macaw or the great military macaw, is a Central and South American parrot found in Nicaragua, Honduras, Costa Rica, Panama, Colombia and Ecuador. Two allopatric subspecies are recognized; the nominate subspecies, Ara ambiguus ssp. ambiguus, occurs from Honduras to Colombia, while Ara ambiguus ssp. guayaquilensis appears to be endemic to remnants of dry forests on the southern Pacific coast of Ecuador. The nominate subspecies lives in the canopy of wet tropical forests and in Costa Rica is usually associated with the almendro tree, Dipteryx oleifera.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAnAgeAmnioteDBAVONET

Size & morphology11

Beak depth74 mm

Beak length (culmen)75 mm

Beak length (nares)71.3 mm

Beak width32.3 mm

Body mass1 300 g

Hand-wing index39.2

Kipp's distance158 mm

Secondary length244 mm

Tail length445 mm

Tarsus length37 mm

Wing length400 mm

Life cycle & reproduction3

Growth rate0.119 /day

Litter size2.4

Max. longevity348 months

Diet & foraging6

Canopy40 %

Fruit50 %

Midhigh60 %

Seed50 %

Trophic levelherbivore

Trophic nicheGranivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size108 292 km²

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ara ambiguus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes2

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

7Cmostly conserved

11Tmostly conserved

13Gmostly conserved

19Gmostly conserved

43Gmostly conserved

49Amostly conserved

70Amostly conserved

121Amostly conserved

139Cmostly conserved

160Amostly conserved

199Gmostly conserved

211Cmostly conserved

251Cmostly conserved

286Amostly conserved

319Cmostly conserved

322Amostly conserved

325Cmostly conserved

334Gmostly conserved

343Gmostly conserved

364Tmostly conserved

370Amostly conserved

376Gmostly conserved

379Amostly conserved

388Cmostly conserved

419Avariable

438Tmostly conserved

457Tmostly conserved

475Cmostly conserved

502Gmostly conserved

511Amostly conserved

538Gmostly conserved

574Cmostly conserved

TGGCACCGCCTTGAGCCTGCTCATCCGTGCAGAACTCGGTCAGCCAGGAACCCTCCTAGGAGACGACCAAATCTATAATGTAGTTGTCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BINs2

Most divergent pair0.96%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ara macaosame genus2.6%Ara chloropterussame genus3.4%Ara araraunasame genus5.1%Ara severussame genus7.2%Cyanoliseus patagonussame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082166 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S16S

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ara ambiguus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 339 860 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ara ambiguus1.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 374 records

Wild obs. + sensor1 361

Museum / vouchered13

Origin

Native3

Range

Area of Occupancy AOO2 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 408≤1 km 49≤10 km 1>10 km 840

1 298 georeferenced · 63 without coordinates

Open the mapobservation + sensor1 361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Caldas (UCaldas)location not on record	8
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
Copenhagen, DK	1
Musée des Confluenceslocation not on record	1

4 institutions · 13 of 13 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Ara ambiguus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ara ambiguus

At a glance

Sources11 archives

Size & morphology11

Life cycle & reproduction3

Diet & foraging6

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 374 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 374 records