Araneus saevus

(L.Koch, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records1 853

Data sources9

Biological traits6

DNA specimens119

eDNA detections117

Sources9 archives

Databases and archives Araneus saevus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 853 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI117 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics119 specimens↗

World Spider Trait DBMasaryk University6 traits · 16 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements16 literature sources6 traits

Occurrence & distributionGBIF1 853 records

Environmental DNA1 datasets · 3 countries117 detections

DNA & barcodingBOLD119 specimens

01Narrative

Araneus saevus is a species of orb weaver in the spider family Araneidae. It is found in North America, Europe, and Russia (Far East).

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 16 sources

Buchar & Růžička 2002Staręga et al. 2001Hyvärinen et al. 2019Henriksen & Hilmo 2015Gajdoš et al. 2014SLU 2020Gajdoš & Svatoň 2001Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Hiebsch & Tolke 1996Sacher & Platen 2004Noflatscher 1994Staręga et al. 2002Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀14.2·♂12 mm

Predation1

Hunting guildorb web weavers

Ecology4

Light 2partly shaded

Moisture 2semi-humid

Regional IUCN Red List categoryEndangered (EN)

Regional non-IUCN Red List categoryRegionally Extinct (RE)

05DNA & barcoding119 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus saevus has left across the world's sequence archives.

At a glance

DNA specimens119

BINs2

Marker genes1

eDNA detections117

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus91 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

1Gmostly conserved

2Amostly conserved

3Tmostly conserved

4Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Cmostly conserved

22Gmostly conserved

30Cmostly conserved

40Tmostly conserved

73Gmostly conserved

91Amostly conserved

106Cmostly conserved

271Tmostly conserved

382Gmostly conserved

415Gmostly conserved

616Tmostly conserved

622Cmostly conserved

625Tmostly conserved

652Cmostly conserved

GATTTTATACTTGATTTTTGGGGCATGAGCGGCTATAGTTGGAACAGCAATAAGAGTATTGATTCGAATTGAGTTAGGTCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes10

BINs2

Most divergent pair3.7%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus variegatussame genus9.6%Araneus alsinesame genus10.2%Araneus ivieisame genus10.4%Araneus groenlandicolasame genus10.4%Araneus diadematussame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 853 records

Wild obs. + sensor1 558

Museum / vouchered295

Origin

Native2

Range

Area of Occupancy AOO6 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 834≤1 km 237≤10 km 118>10 km 143

1 332 georeferenced · 226 without coordinates

Open the mapobservation + sensor1 558

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 19≤1 km 11≤10 km 20>10 km 42

92 georeferenced · 203 without coordinates

Open the institutions mapphysical evidence295

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	60
Helsinki, FI	42
Edmonton, CA	24
Denver, US	14
Cambridge, US	10
Ekaterinburg, RU	10
Ohio State University Acarology Laboratorylocation not on record	6
SLU Artdatabankenlocation not on record	6
University of Alberta Museums (UAM)location not on record	3
SOVTlocation not on record	3
University of Oulu, Zoological Museumlocation not on record	2
WIlocation not on record	1
Cincinnati, US	1
NTNU-VMlocation not on record	1
University of Alaska Museumlocation not on record	1
Saint John, CA	1
Centre for Biodiversity Genomicslocation not on record	1
Chicago, US	1
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	1
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1

20 institutions · 189 of 295 vouchered records shown · 106 without an institution code

09Environmental DNA117 detections

Where the DNA of Araneus saevus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found117

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 117 detections have coordinates

Open the map3 countries0

Riparian Zoneforest canopy14. Artificial - Terrestrial | 14.4 Rural Ga…17. OtherGrasslandon Hemlock

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 8.30–16.9

Seasonal swing summer↔winter25.9 °C

Max temp (day)18.7 °C 12.5–23.2

Min temp (night)9.20 °C 3.30–13.2

Precipitation89.2 mm/mo 56.9–140

Air humidity58.5 % 51.7–62.6

Moisture balance-19.2 mm/mo -69.6–26.0

Vapour deficit680 Pa 426–887

Wind speed2.60 m/s 2.00–4.40

Cloud cover40.0 % 31.8–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 114 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araneus saevus

At a glance

Sources9 archives

Morphometry1

Predation1

Ecology4

At a glance

Record type1 853 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 853 records