Araneus iviei

(Archer, 1951) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records171

Data sources8

Biological traits0

DNA specimens18

eDNA detections18

Sources8 archives

Databases and archives Araneus iviei's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility171 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF171 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Araneus iviei is a species of orb weaver in the spider family Araneidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus iviei has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Gmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Gmostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

32Gmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

37Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

46Gmostly conserved

47Gmostly conserved

48Cmostly conserved

49Amostly conserved

51Tmostly conserved

52Gmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

56Gmostly conserved

59Tmostly conserved

61Gmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

69Tmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

121Avariable

181Gmostly conserved

515Gmostly conserved

553Cmostly conserved

625Gvariable

AACTTTATATTTGATTTTTGGGGCTTGAGCTGCTATAGTGGGGACGGCAATGAGAGTGTTGATTCGAATTGAATTAGGACATCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus alsinesame genus4.4%Nuctenea umbraticasame family10.0%Neoscona pratensissame family10.2%Araneus saevussame genus10.4%Cyrtarachne yunoharuensissame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type171 records

Wild obs. + sensor127

Museum / vouchered44

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 72≤1 km 15≤10 km 9>10 km 14

110 georeferenced · 17 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Cambridge, US	7
University of Alberta Museums (UAM)location not on record	6
Ohio State University Acarology Laboratorylocation not on record	2
Denver, US	2
Edmonton, CA	2
WIlocation not on record	1

7 institutions · 28 of 44 vouchered records shown · 16 without an institution code

09Environmental DNA18 detections

Where the DNA of Araneus iviei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

BogForest5. Wetlands (inland) | 5.4. Bogs, Marshes, S…GrasslandWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 13.7–17.1

Seasonal swing summer↔winter32.8 °C

Max temp (day)21.3 °C 18.8–22.9

Min temp (night)12.0 °C 9.20–12.7

Precipitation80.7 mm/mo 73.4–112

Air humidity57.7 % 55.3–58.9

Moisture balance-47.3 mm/mo -52.4–-11.6

Vapour deficit738 Pa 681–803

Wind speed2.80 m/s 1.90–3.90

Cloud cover39.0 % 36.1–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)