Araneus alsine

(Walckenaer, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records1 464

Data sources8

Biological traits9

DNA specimens12

eDNA detections18

Sources8 archives

Databases and archives Araneus alsine's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 464 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University9 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources9 traits

Occurrence & distributionGBIF1 464 records

Environmental DNA3 datasets · 7 countries18 detections

DNA & barcodingBOLD12 specimens

01Narrative

Araneus alsine, the strawberry spider or orange wheelweaving spider, is a species of the orb-weaving spider family, Araneidae.Catalogue of lifeBiolib

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Pekár 2014aBuchar & Růžička 2002SLU 2020Gajdoš et al. 2014Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Groppali & Priano 1992Komposch & Steinberger 1999Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀13.45·♂7.5 mm

Predation1

Hunting guildorb web weavers

Ecology5

Circadian activitynocturnal

Light 2partly shaded

Moisture 2humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (2)

Defence2

Primary defenceCrypsis

Retreatleaf

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus alsine has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections18

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

43Tvariable

49Amostly conserved

61Gvariable

97Gvariable

118Tmostly conserved

145Amostly conserved

181Amostly conserved

196Gvariable

200Gmostly conserved

217Gmostly conserved

304Avariable

316Avariable

319Amostly conserved

343Tmostly conserved

346Tvariable

370Cvariable

403Gvariable

430Gvariable

466Avariable

478Amostly conserved

515Gmostly conserved

528Cmostly conserved

AACTTTATATTTGATTTTTGGGGCTTGAGCTGCTATAGTGGGTACGGCAATAAGAGTGTTGATTCGAATTGAATTAGGACAGCCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BINs2

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus ivieisame genus4.4%Araneus saevussame genus10.2%Nuctenea umbraticasame family10.6%Cyrtarachne yunoharuensissame family11.2%Poecilopachys australasiasame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 464 records

Wild obs. + sensor1 190

Museum / vouchered269

Other5

Origin

Native7

Range

Area of Occupancy AOO4 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 455≤1 km 230≤10 km 315>10 km 30

1 030 georeferenced · 160 without coordinates

Open the mapobservation + sensor1 190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 14≤1 km 25≤10 km 81>10 km 63

183 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence269

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	73
Brussels, BE	37
Ekaterinburg, RU	31
Tartu, EE	16
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	13
Uniwersytet w Białymstokulocation not on record	7
Frankfurt am Main	6
Bern, CH	6
SLU Artdatabankenlocation not on record	6
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	6
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	4
Copenhagen, DK	3
Washington, US	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
	2
Akademia Pomorska w Słupskulocation not on record	2
Natural History Museum, Londonlocation not on record	1
Bonn, DE	1
Buenos Aires, AR	1
Tilburg, NL	1
Rovaniemi, FI	1
Liverpool, GB	1
Metsähallituslocation not on record	1
BioFokuslocation not on record	1
NTNU-VMlocation not on record	1
Karlstads Universitetlocation not on record	1
South Kensington, GB	1
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1

30 institutions · 235 of 269 vouchered records shown · 31 without an institution code

09Environmental DNA18 detections

Where the DNA of Araneus alsine was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys3

Countries7

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map7 countries0

Feuchtheide, in niedriger Vegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 8.70–16.6

Seasonal swing summer↔winter22.5 °C

Max temp (day)16.6 °C 11.9–20.6

Min temp (night)9.40 °C 5.80–12.6

Precipitation76.4 mm/mo 65.4–91.6

Air humidity62.1 % 58.1–64.2

Moisture balance4.40 mm/mo -29.4–44.0

Vapour deficit617 Pa 419–776

Wind speed2.50 m/s 2.20–5.00

Cloud cover52.7 % 42.6–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araneus alsine

At a glance

Sources8 archives

Morphometry1

Predation1

Ecology5

Defence2

At a glance

Record type1 464 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 464 records