Araneus bicentenarius

(McCook, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araneus

At a glance

Occurrence records3 116

Data sources9

Biological traits3

DNA specimens23

eDNA detections22

Sources9 archives

Databases and archives Araneus bicentenarius's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University3 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources3 traits

Occurrence & distributionGBIF3 116 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD23 specimens

01Narrative

Araneus bicentenarius, the giant lichen orbweaver, is a species of orb weaver in the family Araneidae. It is found in the USA and Canada.Dean DA (2016). "Catalogue of Texas spiders". ZooKeys 570: 1-703. Giant Lichen Orbweaver, Araneus bicentenarius, Summit, CO, USA

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aBirkhofer & Wolters 2012Pekár et al. 2012a

Predation2

Prey OrderHymenoptera

Prey diversity7.03 mm

Defence1

Primary defenceCrypsis

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araneus bicentenarius has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes2

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

46Cmostly conserved

316Gmostly conserved

340Tmostly conserved

343Cmostly conserved

346Cmostly conserved

352Cmostly conserved

376Tmostly conserved

401Cmostly conserved

403Amostly conserved

478Amostly conserved

595Cmostly conserved

604Cmostly conserved

610Tmostly conserved

616Cvariable

622Tmostly conserved

634Cmostly conserved

641Cmostly conserved

GACTTTATATTTAGTTTTTGGGGCTTGAGCTGCTATAGTAGGGACCGCGATAAGGGTATTAATCCGAATTGAATTAGGTCAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes10

BINs2

Most divergent pair3.5%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araneus reizansame genus12.3%Araneus affinissame genus12.6%Argiope modestasame family12.6%Argiope appensasame family12.6%Araneus ivieisame genus12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type3 116 records

Wild obs. + sensor3 092

Museum / vouchered24

Range

Area of Occupancy AOO9 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 1 658≤1 km 411≤10 km 194>10 km 347

2 610 georeferenced · 482 without coordinates

Open the mapobservation + sensor3 092

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 3≤10 km 8

12 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	7
Denver, US	6
Ohio State University Acarology Laboratorylocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Chicago, US	2
Centre for Biodiversity Genomicslocation not on record	1
Champaign, US	1

7 institutions · 23 of 24 vouchered records shown · 1 without an institution code

09Environmental DNA22 detections

Where the DNA of Araneus bicentenarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 17.1–23.6

Seasonal swing summer↔winter26.8 °C

Max temp (day)23.9 °C 19.4–29.0

Min temp (night)17.2 °C 14.0–19.7

Precipitation91.8 mm/mo 81.3–113

Air humidity61.1 % 58.0–62.1

Moisture balance-49.6 mm/mo -72.4–-20.1

Vapour deficit896 Pa 732–1,151

Wind speed2.70 m/s 2.10–3.90

Cloud cover39.7 % 32.7–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araneus bicentenarius

At a glance

Sources9 archives

Predation2

Defence1

At a glance

Record type3 116 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 116 records