Arachosia praesignis

(Keyserling, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Arachosia

At a glance

Occurrence records529

Data sources8

Biological traits6

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Arachosia praesignis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility529 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University6 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF529 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Arachosia praesignis is een spinnensoort in de taxonomische indeling van de buisspinnen (Anyphaenidae). Het dier behoort tot het geslacht Arachosia. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1891 door Eugen von Keyserling.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCeccarelli et al. 2019

Morphometry4

Cephalothorax length2.77 mm

Cephalothorax width2.07 mm

Chelicerae basal part (paturon) length1 mm

Tibia III length1.27 mm

Ecology2

IUCN Habitatforest

Microhabitatfoliage

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachosia praesignis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.46%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

238Tmostly conserved

268Amostly conserved

499Amostly conserved

TACTTTATATTTAATGTTTGGTGCTTGATCTGCTATAGCAGGAACTGCTATGAGAGTTTTAATTCGTATAGAATTAGGTCATTCGGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arachosia bergisame genus10.2%Arachosia kapiipeoisame genus10.2%Tomopisthes horrendussame family10.5%Gayenna americanasame family10.6%Sanogasta mandibularissame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type529 records

Wild obs. + sensor455

Museum / vouchered74

Range

Area of Occupancy AOO1 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 161≤1 km 119≤10 km 55>10 km 10

345 georeferenced · 110 without coordinates

Open the mapobservation + sensor455

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 8≤1 km 18≤10 km 19>10 km 22

67 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	67
PUC-RSlocation not on record	3
Instituto Biologico de Sao Paulolocation not on record	1

3 institutions · 71 of 74 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Arachosia praesignis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 12.8–21.9

Seasonal swing summer↔winter13.2 °C

Max temp (day)22.1 °C 16.1–25.9

Min temp (night)13.0 °C 10.0–18.3

Precipitation122 mm/mo 78.2–140

Air humidity60.4 % 58.3–62.4

Moisture balance11.8 mm/mo -37.8–39.4

Vapour deficit785 Pa 577–1,088

Wind speed2.60 m/s 2.20–2.70

Cloud cover30.7 % 28.2–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)