Arachosia bergi

(Simon, 1880) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Arachosia

At a glance

Occurrence records74

Data sources7

Biological traits6

DNA specimens12

eDNA detections12

Sources7 archives

Databases and archives Arachosia bergi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University6 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Arachosia bergi is een spinnensoort in de taxonomische indeling van de buisspinnen (Anyphaenidae). Het dier behoort tot het geslacht Arachosia. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1880 door Eugène Simon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCeccarelli et al. 2019

Morphometry4

Cephalothorax length3.19 mm

Cephalothorax width2.37 mm

Chelicerae basal part (paturon) length1.03 mm

Tibia III length1.63 mm

Ecology2

IUCN Habitatgrassland

Microhabitatgrass

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachosia bergi has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Tmostly conserved

37Amostly conserved

52Avariable

73Amostly conserved

112Amostly conserved

193Cmostly conserved

266Cmostly conserved

274Gmostly conserved

331Gmostly conserved

542Tmostly conserved

583Amostly conserved

TACTTTATATTTGATGTTTGGAGCGTGATCTGCTATAGCAGGTACTGCTATAAGAGTTTTGATTCGTATAGAATTAGGGCATTCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes5

BIN1

Most divergent pair0.76%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arachosia avalosisame genus3.2%Arachosia kapiipeoisame genus3.3%Arachosia cubanasame genus8.4%Sanogasta rufithoraxsame family9.7%Araiya coccineasame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor2

Museum / vouchered72

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 7≤1 km 15≤10 km 28>10 km 10

60 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	62

1 institutions · 62 of 72 vouchered records shown · 10 without an institution code

09Environmental DNA12 detections

Where the DNA of Arachosia bergi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

BaÃ±adoBa??ado en laguna. Extensi??n de colecta, no…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 13.9–23.6

Seasonal swing summer↔winter12.9 °C

Max temp (day)20.7 °C 18.4–28.2

Min temp (night)13.2 °C 10.7–19.5

Precipitation82.5 mm/mo 49.4–161

Air humidity60.2 % 59.4–61.9

Moisture balance-6.80 mm/mo -19.6–29.3

Vapour deficit731 Pa 600–1,173

Wind speed3.80 m/s 2.40–4.20

Cloud cover36.4 % 33.8–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)