Araiya coccinea — The Life Data

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Araiya

At a glance

Occurrence records11

Data sources6

Biological traits4

DNA specimens9

eDNA detections0

Sources6 archives

Databases and archives Araiya coccinea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University4 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF11 records

DNA & barcodingBOLD9 specimens

01Narrative

Araiya coccinea is een spinnensoort in de taxonomische indeling van de buisspinnen (Anyphaenidae). Het dier behoort tot het geslacht Araiya. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1884 door Eugène Simon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCeccarelli et al. 2019

Morphometry4

Cephalothorax length2.33 mm

Cephalothorax width1.8 mm

Chelicerae basal part (paturon) length0.9 mm

Tibia III length1.2 mm

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araiya coccinea has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 6 variable positions, in barcode order

110Tmostly conserved

163Amostly conserved

190Amostly conserved

221Cmostly conserved

417Cmostly conserved

529Amostly conserved

TACTTTGTATTTAATGTTTGGAGCTTGATCTGCTATAGCAGGTACTGCTATAAGAGTATTGATTCGAATAGAATTAGGACATTCAGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araiya pallidasame genus2.1%Philisca pizarroisame family8.7%Philisca robinsonsame family9.0%Philisca ingenssame family9.3%Tomopisthes variussame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type11 records

Museum / vouchered11

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	4

1 institutions · 4 of 11 vouchered records shown · 7 without an institution code