Arachosia kapiipeoi

Rubio & Ramírez, 2015 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Anyphaenidae/Arachosia

At a glance

Occurrence records54

Data sources5

Biological traits6

DNA specimens15

eDNA detections0

Sources5 archives

Databases and archives Arachosia kapiipeoi's data was compiled from.

GBIFGlobal Biodiversity Information Facility54 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

World Spider Trait DBMasaryk University6 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF54 records

DNA & barcodingBOLD15 specimens

02Traits & measurements

SourcesCeccarelli et al. 2019

Morphometry4

Cephalothorax length3.2 mm

Cephalothorax width2.3 mm

Chelicerae basal part (paturon) length0.98 mm

Tibia III length1.5 mm

Ecology2

IUCN Habitatgrassland

Microhabitatgrass, fern, bark

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arachosia kapiipeoi has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

7Gmostly conserved

31Cmostly conserved

76Amostly conserved

139Amostly conserved

190Tmostly conserved

244Gmostly conserved

253Gmostly conserved

262Gmostly conserved

271Amostly conserved

277Amostly conserved

286Amostly conserved

331Gmostly conserved

343Amostly conserved

357Cmostly conserved

367Cmostly conserved

369Gmostly conserved

373Amostly conserved

448Tmostly conserved

451Tmostly conserved

483Cmostly conserved

533Tmostly conserved

577Amostly conserved

580Amostly conserved

583Gmostly conserved

601Tmostly conserved

TACTTTGTATTTGATGTTTGGAGCGTGATCCGCTATAGCAGGTACTGCTATAAGAGTTTTGATTCGTATAGAATTAGGACATTCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.65%

Haplotypes8

BIN1

Most divergent pair2.3%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arachosia bergisame genus3.3%Arachosia avalosisame genus3.5%Arachosia cubanasame genus7.9%Arachosia praesignissame genus10.2%Gayenna americanasame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor4

Museum / vouchered50

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 5≤1 km 14≤10 km 15

34 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	36

1 institutions · 36 of 50 vouchered records shown · 14 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)