Aquilonastra watersi

O'Loughlin & Rowe, 2006 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Asteroidea/Valvatida/Asterinidae/Aquilonastra

At a glance

Occurrence records45

Data sources7

Biological traits4

DNA specimens13

eDNA detections8

Sources7 archives

Databases and archives Aquilonastra watersi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS45 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD13 specimens

01Narrative

Aquilonastra watersi is een zeester uit de familie Asterinidae. De wetenschappelijke naam van de soort werd in 2006 gepubliceerd door O'Loughlin & Rowe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max24 m

Depth min0 m

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilonastra watersi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P667 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

20Cmostly conserved

35Tmostly conserved

77Gvariable

86Cmostly conserved

164Tmostly conserved

266Avariable

293Cmostly conserved

302Tmostly conserved

308Amostly conserved

347Tmostly conserved

354Cmostly conserved

368Tmostly conserved

392Cmostly conserved

431Tmostly conserved

467Cmostly conserved

473Cmostly conserved

482Cmostly conserved

497Gmostly conserved

528Cmostly conserved

534Cmostly conserved

573Cmostly conserved

578Cmostly conserved

607Tmostly conserved

608Cmostly conserved

609Gmostly conserved

610Amostly conserved

611Tmostly conserved

612Cmostly conserved

614Amostly conserved

615Gmostly conserved

616Cmostly conserved

617Amostly conserved

618Gmostly conserved

620Amostly conserved

621Gmostly conserved

623Cmostly conserved

624Gmostly conserved

652Tmostly conserved

TATATCTTATCTTCGGAGCCTGAGCCGGAATGGCTGGAACCGCAATGAGAGTAATAATACGAACAGAATTAGCTCAGCCAGGCTCCCTCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes4

BIN1

Most divergent pair0.45%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aquilonastra yairisame genus4.6%Aquilonastra samynisame genus13.3%Aquilonastra coronatasame genus13.3%Aquilonastra anomalasame genus14.4%Henricia pacificasame order14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor3

Museum / vouchered42

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 42 records without

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	21

1 institutions · 21 of 42 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Aquilonastra watersi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)