Aquilonastra anomala

(H.L.Clark, 1921) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Asteroidea/Valvatida/Asterinidae/Aquilonastra

At a glance

Occurrence records246

Data sources7

Biological traits4

DNA specimens8

eDNA detections5

Sources7 archives

Databases and archives Aquilonastra anomala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

OBISOcean Biodiversity Information System106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS246 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aquilonastra anomala is een zeester uit de familie Asterinidae. De wetenschappelijke naam van de soort werd in 1921 gepubliceerd door Hubert Lyman Clark.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max37 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilonastra anomala has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Diversity (π)7.6%

Haplotypes1

BINs3

Where individuals differ — all 97 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

11Cmostly conserved

13Tmostly conserved

14Amostly conserved

16Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Amostly conserved

23Gmostly conserved

24Cmostly conserved

25Cmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

37Gmostly conserved

39Cmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

46Cmostly conserved

47Gmostly conserved

48Cmostly conserved

49Amostly conserved

51Tmostly conserved

52Gmostly conserved

53Amostly conserved

54Gmostly conserved

56Gmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Cmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Cmostly conserved

79Cmostly conserved

81Amostly conserved

82Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Tmostly conserved

86Gmostly conserved

87Gmostly conserved

88Cmostly conserved

89Tmostly conserved

90Cmostly conserved

94Cmostly conserved

96Tmostly conserved

97Tmostly conserved

98Cmostly conserved

100Amostly conserved

103Gvariable

124Cmostly conserved

143Gmostly conserved

172Tmostly conserved

202Cvariable

235Tmostly conserved

277Tmostly conserved

283Amostly conserved

301Tmostly conserved

302Gmostly conserved

319Cvariable

322Amostly conserved

337Tmostly conserved

385Cmostly conserved

403Gvariable

427Cvariable

478Cmostly conserved

496Cmostly conserved

538Amostly conserved

541Gmostly conserved

553Cmostly conserved

565Cmostly conserved

613Cmostly conserved

658Tvariable

AACACTATATCTTATATTTGGAGCCTGAGCCGGAATGGCTGGCACCGCAATGAGAGTAATAATACGAACAGAACTAGCCCAACCTGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aquilonastra coronatasame genus11.2%Aquilonastra watersisame genus14.4%Aquilonastra burtonisame genus14.6%Aquilonastra samynisame genus15.5%Patiria miniatasame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type246 records

Wild obs. + sensor43

Museum / vouchered203

Range

Area of Occupancy AOO380 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 80 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 12≤1 km 8≤10 km 1

21 georeferenced · 22 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 64≤10 km 31>10 km 3

111 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence203

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	34
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	22
Cambridge, US	11
Museums Victorialocation not on record	6
Washington, US	6
Western Australian Museumlocation not on record	6
Los Angeles, US	5
Tasmanian Museum & Art Gallerylocation not on record	5
Museum and Art Gallery of the Northern Territorylocation not on record	4
University of Floridalocation not on record	3
Natick, US	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

12 institutions · 104 of 203 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Aquilonastra anomala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

patch reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 16.7–20.1

Seasonal swing summer↔winter3.90 °C

Max temp (day)22.7 °C 19.0–22.7

Min temp (night)18.1 °C 14.0–18.1

Precipitation90.5 mm/mo 90.5–176

Air humidity71.8 % 61.9–71.8

Moisture balance-73.7 mm/mo -73.7–48.3

Vapour deficit663 Pa 663–718

Wind speed5.40 m/s 2.40–5.40

Cloud cover33.6 % 33.6–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)