Aquilonastra coronata

(von Martens, 1866) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Asteroidea/Valvatida/Asterinidae/Aquilonastra

At a glance

Occurrence records507

Data sources7

Biological traits4

DNA specimens8

eDNA detections2

Sources7 archives

Databases and archives Aquilonastra coronata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility362 records↗

OBISOcean Biodiversity Information System145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS507 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD8 specimens

01Narrative

Aquilonastra coronata is een zeester uit de familie Asterinidae. De wetenschappelijke naam van de soort werd in 1866 gepubliceerd door von Martens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max18 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aquilonastra coronata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P712 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

569Tmostly conserved

ATGCAACTAAGACGATGATTCTTTTCCACCAAACACAAGGACATTGGAACACTATATCTTATATTCGGAGCCTGAGCCGGTATGGCTGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aquilonastra anomalasame genus11.2%Aquilonastra watersisame genus13.3%Aquilonastra burtonisame genus13.4%Aquilonastra samynisame genus15.5%Paralophaster antarcticussame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type507 records

Wild obs. + sensor365

Museum / vouchered142

Range

Area of Occupancy AOO356 km²

Depth

0–200 m sunlit7

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 7.8 m · max 58 m · 7 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 71≤1 km 25≤10 km 2>10 km 3

101 georeferenced · 264 without coordinates

Open the mapobservation + sensor365

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 16≤1 km 29≤10 km 32>10 km 5

82 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	22
Cambridge, US	16
Museum and Art Gallery of the Northern Territorylocation not on record	15
Western Australian Museumlocation not on record	9
Tasmanian Museum & Art Gallerylocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
FURGlocation not on record	1
Paris, FR	1
Natick, US	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

10 institutions · 72 of 142 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Aquilonastra coronata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)