Apteronotus mariae

(Eigenmann & Fisher, 1914) · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Apteronotus

At a glance

Occurrence records228

Data sources7

Biological traits5

DNA specimens5

eDNA detections7

Sources7 archives

Databases and archives Apteronotus mariae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF228 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD5 specimens

01Narrative

Apteronotus mariae is een straalvinnige vissensoort uit de familie van de staartvinmesalen (Apteronotidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1914 door Eigenmann & Fisher.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length27.3 cm

Body mass61.4 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability23.31

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apteronotus mariae has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P609 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.78%

Haplotypes2

BIN1

Most divergent pair0.82%

Where individuals differ — all 8 variable positions, in barcode order

9Gvariable

177Avariable

243Avariable

312Avariable

360Tmostly conserved

492Avariable

540Avariable

577Tvariable

GGTGCCTGGGCGGGTATAATTGGTACTGCTCTTAGCCTGCTAATTCGAGCAGAGCTTAATCAACCAGGTACCCTCCTAGAAGACGACCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apteronotus bonapartiisame genus9.2%Apteronotus ellisisame genus9.4%Parapteronotus hasemanisame family10.3%Apteronotus eschmeyerisame genus10.5%Apteronotus rostratussame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type228 records

Wild obs. + sensor156

Museum / vouchered72

Origin

Native114

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 156 records without

Open the mapobservation + sensor156

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 8≤1 km 18≤10 km 4

30 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	25
Universidad Católica de Oriente (UCO)location not on record	14
Universidad de Antioquia (UdeA)location not on record	8
University of Nebraskalocation not on record	7
Pontificia Universidad Javeriana (PUJ)location not on record	6
Universidad del Tolima (UT)location not on record	6
Universidad de La Salle (La Salle)location not on record	2
Chicago, US	2
Montgomery, US	1
CASlocation not on record	1

10 institutions · 72 of 72 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Apteronotus mariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Cuerpo de agua lentico

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 25.5–26.5

Seasonal swing summer↔winter1.50 °C

Max temp (day)28.9 °C 28.9–29.9

Min temp (night)23.5 °C 20.8–23.5

Precipitation262 mm/mo 200–262

Air humidity70.5 % 58.9–70.5

Moisture balance141 mm/mo 68.7–141

Vapour deficit1,015 Pa 1,015–1,340

Wind speed1.10 m/s 1.10–1.70

Cloud cover31.7 % 31.7–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)