Apteronotus bonapartii

(Castelnau, 1855) · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Apteronotus

At a glance

Occurrence records288

Data sources7

Biological traits6

DNA specimens13

eDNA detections16

Sources7 archives

Databases and archives Apteronotus bonapartii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility288 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF288 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD13 specimens

01Narrative

Apteronotus bonapartii is een straalvinnige vissensoort uit de familie van de staartvinmesalen (Apteronotidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1855 door Castelnau.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length38 cm

Body mass138 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability36.36

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apteronotus bonapartii has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

3Cmostly conserved

9Avariable

30Gmostly conserved

39Amostly conserved

72Cmostly conserved

78Tvariable

96Cvariable

120Cvariable

153Cvariable

180Tmostly conserved

198Gvariable

216Tmostly conserved

222Avariable

231Gvariable

237Tvariable

252Tvariable

264Gvariable

276Amostly conserved

279Amostly conserved

282Tvariable

288Amostly conserved

291Tvariable

312Gvariable

318Gmostly conserved

333Gvariable

357Tmostly conserved

360Cvariable

366Cvariable

375Avariable

381Tvariable

408Tvariable

414Avariable

432Tvariable

462Tvariable

465Cvariable

468Gvariable

471Amostly conserved

483Gmostly conserved

486Tvariable

495Avariable

501Avariable

504Amostly conserved

513Gvariable

519Avariable

528Tmostly conserved

570Tmostly conserved

582Avariable

585Tvariable

621Tvariable

624Gmostly conserved

655Cvariable

657Avariable

GGCACACTATACATAGTGTTTGGCGCCTGGGCGGGTATAATTGGTACTGCTCTTAGCCTTCTAATCCGGGCCGAGCTTAATCAACCAGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes6

BINs3

Most divergent pair5.8%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Porotergus gimbelisame family6.4%Porotergus gymnotussame family6.7%Sternarchogiton labiatussame family7.4%Porotergus duendesame family7.9%Sternarchogiton porcinumsame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type288 records

Wild obs. + sensor4

Museum / vouchered284

Origin

Native7

Range

Area of Occupancy AOO808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 3 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤10 km 2>10 km 5

8 georeferenced · 276 without coordinates

Open the institutions mapphysical evidence284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	58
Washington, US	56
Museu de Zoologia da Universidade de Sao Paulolocation not on record	37
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	25
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	21
PUC-RSlocation not on record	18
University of Nebraskalocation not on record	10
Los Angeles, US	7
Champaign, US	6
Musee Royal d'Histoire Naturelle de Belgiquelocation not on record	6
Montgomery, US	5
Cambridge, US	5
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
South African Institute for Aquatic Biodiversitylocation not on record	4
UNICAMPlocation not on record	3
CASlocation not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Toronto, CA	2
Museo de Historia Natural “Gustavo Orcés V"location not on record	1
Geneva, CH	1
Museu Paraense Emílio Goeldilocation not on record	1
South Kensington, GB	1
Ann Arbor, US	1

24 institutions · 282 of 284 vouchered records shown · 2 without an institution code

09Environmental DNA16 detections

Where the DNA of Apteronotus bonapartii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 26.4–26.4

Seasonal swing summer↔winter1.20 °C

Max temp (day)29.2 °C

Min temp (night)23.8 °C

Precipitation254 mm/mo

Air humidity71.4 %

Moisture balance125 mm/mo

Vapour deficit983 Pa

Wind speed1.20 m/s

Cloud cover53.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)