Apteronotus eschmeyeri

de Santana, Maldonado-Ocampo, Severi & Mendes, 2004 · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Apteronotus

At a glance

Occurrence records1 128

Data sources7

Biological traits4

DNA specimens28

eDNA detections26

Sources7 archives

Databases and archives Apteronotus eschmeyeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF1 128 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD28 specimens

01Narrative

Apteronotus eschmeyeri est une espèce de poissons gymnotiformes de la famille des Apteronotidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length32 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability29.04

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apteronotus eschmeyeri has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes1

eDNA detections26

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

15Amostly conserved

28Tmostly conserved

60Cmostly conserved

66Tmostly conserved

75Tmostly conserved

96Tmostly conserved

123Tmostly conserved

141Amostly conserved

144Cmostly conserved

156Tmostly conserved

168Amostly conserved

171Cmostly conserved

178Cmostly conserved

183Gmostly conserved

207Cmostly conserved

234Amostly conserved

237Amostly conserved

252Cmostly conserved

255Tmostly conserved

285Cmostly conserved

291Cmostly conserved

300Cmostly conserved

303Amostly conserved

315Cmostly conserved

318Cmostly conserved

321Cmostly conserved

324Tmostly conserved

325Gmostly conserved

330Cmostly conserved

336Amostly conserved

348Tmostly conserved

360Gmostly conserved

381Gmostly conserved

390Cmostly conserved

396Tmostly conserved

402Amostly conserved

408Tmostly conserved

414Tmostly conserved

423Cmostly conserved

432Tmostly conserved

438Amostly conserved

453Amostly conserved

459Gmostly conserved

462Tmostly conserved

468Tmostly conserved

472Cmostly conserved

477Cmostly conserved

480Cmostly conserved

483Amostly conserved

486Cmostly conserved

487Tmostly conserved

490Cmostly conserved

498Cmostly conserved

501Cmostly conserved

504Cmostly conserved

516Cmostly conserved

519Cmostly conserved

525Tmostly conserved

531Gmostly conserved

540Cmostly conserved

549Amostly conserved

552Tmostly conserved

555Cmostly conserved

564Amostly conserved

567Cmostly conserved

573Tmostly conserved

576Amostly conserved

594Cmostly conserved

603Gmostly conserved

609Amostly conserved

612Tmostly conserved

613Tmostly conserved

621Amostly conserved

625Cmostly conserved

GCGGGTATAATTGGAACTGCTCTTAGCTTGCTAATTCGAGCAGAGCTTAATCAACCAGGCACCCTTCTAGAAGATGACCAAATTTACAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes6

BINs2

Most divergent pair12.0%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apteronotus magdalenensissame genus8.6%Apteronotus galvisisame genus9.8%Parapteronotus hasemanisame family10.1%Apteronotus mariaesame genus10.5%Apteronotus albifronssame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 128 records

Wild obs. + sensor956

Museum / vouchered172

Origin

Native450

Range

Area of Occupancy AOO520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 951 without coordinates

Open the mapobservation + sensor956

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 30≤1 km 62≤10 km 17>10 km 1

110 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Universidad de Antioquia (UdeA)location not on record	48
Universidad del Tolima (UT)location not on record	39
University of Nebraskalocation not on record	23
Universidad Católica de Oriente (UCO)location not on record	20
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	20
Pontificia Universidad Javeriana (PUJ)location not on record	3
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	3
Universidad de Caldas (UCaldas)location not on record	1
CASlocation not on record	1
Universidad de los Andes (UniAndes)location not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Universidad de Antioquialocation not on record	1

12 institutions · 161 of 172 vouchered records shown · 11 without an institution code

09Environmental DNA26 detections

Where the DNA of Apteronotus eschmeyeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

Cuerpo de agua lenticoLoticCuerpo de agua lotico

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 18.3–26.1

Seasonal swing summer↔winter0.9 °C

Max temp (day)25.4 °C 22.6–29.8

Min temp (night)17.8 °C 14.5–22.9

Precipitation206 mm/mo 189–533

Air humidity69.4 % 56.9–73.4

Moisture balance89.6 mm/mo 51.7–425

Vapour deficit814 Pa 558–1,358

Wind speed1.10 m/s 0.8–2.10

Cloud cover39.7 % 16.0–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apteronotus eschmeyeri

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type1 128 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 128 records