Apteronotus galvisi

de Santana, Maldonado-Ocampo & Crampton, 2007 · species

image placeholder — illustration coming later

Animalia/Chordata/Gymnotiformes/Apteronotidae/Apteronotus

At a glance

Occurrence records280

Data sources8

Biological traits4

DNA specimens10

eDNA detections11

Sources8 archives

Databases and archives Apteronotus galvisi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility280 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF280 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Apteronotus galvisi is a species of ghost knifefish that was first described in a 2007 scientific paper. It is endemic to Colombia. It has a mostly brown body, with some areas of yellow or white. Named in honor of Germán Galvis Vergara (Universidad Nacional de Colombia, Sede Bogotá).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length18.44 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apteronotus galvisi has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

25Gvariable

37Cmostly conserved

56Cmostly conserved

197Amostly conserved

214Cmostly conserved

406Gmostly conserved

418Avariable

490Gmostly conserved

529Cmostly conserved

554Cvariable

556Avariable

629Gmostly conserved

ACTTTACATGGTATTTGGTGCCTGGGCAGGCATAATCGGAACTGCTCTTAGCCTACTAATTCGGGCAGAGCTTAATCAACCGGGGACCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes3

BIN1

Most divergent pair0.91%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apteronotus eschmeyerisame genus9.8%Apteronotus mariaesame genus10.5%Porotergus gymnotussame family10.7%Sternarchogiton porcinumsame family11.6%Sternarchorhynchus galibisame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type280 records

Wild obs. + sensor56

Museum / vouchered224

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 6>10 km 1

7 georeferenced · 49 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 41≤10 km 5

46 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	91
Pontificia Universidad Javeriana (PUJ)location not on record	51
Universidad del Tolima (UT)location not on record	42
Universidad de los Llanos (UniLlanos)location not on record	36
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	2
Universidad de La Salle (La Salle)location not on record	1

6 institutions · 223 of 224 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Apteronotus galvisi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 23.2–25.6

Seasonal swing summer↔winter3.00 °C

Max temp (day)28.7 °C 26.7–29.4

Min temp (night)20.6 °C 19.6–21.8

Precipitation250 mm/mo 117–264

Air humidity63.2 % 61.2–64.8

Moisture balance103 mm/mo -6.10–134

Vapour deficit1,155 Pa 1,029–1,198

Wind speed1.00 m/s 0.8–1.10

Cloud cover47.5 % 45.9–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)