Aproaerema suecicella

(Wolff, 1958) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Aproaerema

At a glance

Occurrence records60

Data sources8

Biological traits2

DNA specimens18

eDNA detections17

Sources8 archives

Databases and archives Aproaerema suecicella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 4 countries17 detections

DNA & barcodingBOLD18 specimens

01Narrative

Syncopacma suecicella is a moth of the family Gelechiidae. It was described by Wolff in 1958. It is found in Great Britain, Portugal, Spain, France, Germany, Denmark, Sweden, Austria, Italy, the Czech Republic, Hungary, Greece and Russia, as well as on Sardinia.funet.fiFauna Europaea The wingspan is 9–10 mm.Svenska fjärilar The larvae feed on Genista pilosa, living between leaves spun together with silk.Hants Moths The larvae have a reddish purple body, marbled with grey. The head is honey coloured.bladmineerders.nl

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aproaerema suecicella has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

eDNA detections17

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

38Gmostly conserved

59Cvariable

73Avariable

82Cmostly conserved

121Cvariable

133Tvariable

202Amostly conserved

205Cvariable

217Avariable

250Tvariable

271Tvariable

274Cvariable

287Tvariable

289Avariable

313Tmostly conserved

334Avariable

364Tvariable

368Gmostly conserved

397Tmostly conserved

400Tvariable

403Cvariable

415Avariable

421Tmostly conserved

448Tvariable

460Cvariable

472Cvariable

506Gmostly conserved

514Tvariable

520Avariable

547Avariable

548Tvariable

550Amostly conserved

553Tvariable

565Amostly conserved

578Tvariable

581Cvariable

589Tvariable

607Cvariable

616Cvariable

637Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACATCTCTTAGTTTACTAATTCGAGCAGAATTAGGTAACCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes8

BINs3

Most divergent pair5.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aproaerema metadesmasame genus6.8%Aproaerema captivellasame genus7.1%Aproaerema cincticulellasame genus7.4%Aproaerema vinellasame genus7.4%Aproaerema sangiellasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor41

Museum / vouchered19

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 19≤1 km 21≤10 km 1

41 georeferenced

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 4

6 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	5
South Kensington, GB	3
NHMOlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1

4 institutions · 11 of 19 vouchered records shown · 8 without an institution code

09Environmental DNA17 detections

Where the DNA of Aproaerema suecicella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map4 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 13.8–21.8

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.7 °C 17.9–26.9

Min temp (night)12.7 °C 8.10–15.4

Precipitation74.8 mm/mo 35.4–95.9

Air humidity57.3 % 52.8–58.9

Moisture balance-45.4 mm/mo -111–-8.60

Vapour deficit896 Pa 660–1,234

Wind speed2.80 m/s 1.80–4.40

Cloud cover33.4 % 31.6–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)