Aproaerema vinella

Bankes, 1898 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Aproaerema

At a glance

Occurrence records37

Data sources7

Biological traits2

DNA specimens34

eDNA detections36

Sources7 archives

Databases and archives Aproaerema vinella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 6 countries36 detections

DNA & barcodingBOLD34 specimens

01Narrative

Syncopacma vinella, the Brighton sober, is a moth of the family Gelechiidae. It was described by Bankes in 1898. It is found in Europe, where it has been recorded from Denmark to Hungary, and from Great Britain to Slovakia.funet.fi The wingspan is 10.5–12 mm.microlepidoptera.nl The forewings are rather glossy fuscous-black, tinged with violet and minutely speckled with pale scales. The hindwings are satiny-grey.lepiforum.de The larvae feed on Genista tinctoria, Medicago falcata, Medicago sativa and Trifolium pratense. They mine the leaves of their host plant. They spin a number of leaflets together and bite a hole in the epidermis of the basal part of a leaflet and mine it out almost completely. The colour of the body varies from dull white to almost black, with a brown head.bladmineerders.nl

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aproaerema vinella has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections36

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

88Cvariable

197Cvariable

368Gmostly conserved

616Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACTTCTCTTAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGCCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes8

BIN1

Most divergent pair2.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aproaerema suecicellasame genus7.4%Aproaerema karvonenisame genus7.6%Aproaerema cinctelloidessame genus7.8%Aproaerema ochrofasciellasame genus7.8%Aproaerema metadesmasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor17

Museum / vouchered20

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤1 km 4≤10 km 9

13 georeferenced · 4 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4≤10 km 1

6 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	3
SLU Artdatabankenlocation not on record	1
South Kensington, GB	1

3 institutions · 5 of 20 vouchered records shown · 15 without an institution code

09Environmental DNA36 detections

Where the DNA of Aproaerema vinella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map6 countries0

flooded meadow, salix treesmeadowedge woodland/meadowforest edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 15.0–20.2

Seasonal swing summer↔winter18.8 °C

Max temp (day)23.2 °C 19.0–24.6

Min temp (night)13.8 °C 10.2–15.2

Precipitation71.7 mm/mo 47.8–121

Air humidity57.9 % 56.8–59.5

Moisture balance-46.3 mm/mo -82.8–-10.7

Vapour deficit905 Pa 692–1,013

Wind speed2.90 m/s 2.40–3.60

Cloud cover36.0 % 33.4–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)