Aproaerema captivella

(Herrich-Schäffer, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Aproaerema

At a glance

Occurrence records33

Data sources8

Biological traits0

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Aproaerema captivella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Syncopacma captivella is a moth of the family Gelechiidae. It was described by Gottlieb August Wilhelm Herrich-Schäffer in 1854. It is found in Portugal, Spain, France, Belgium, the Netherlands, Switzerland, Germany, Italy, Hungary, Poland, the Czech Republic, Croatia and Romania.Fauna Europaea The larvae feed on Cytisus scoparius and Genista legionensis.Syncopacma captivella (Herrich-Schäffer, 1854) new to Spain, reared from a new larval foodplant (Lepidoptera: Gelechiidae)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aproaerema captivella has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes1

BINs2

Where individuals differ — all 22 variable positions, in barcode order

56Tvariable

59Tvariable

85Tvariable

100Avariable

127Tvariable

136Cvariable

220Tvariable

238Cvariable

271Cvariable

287Tvariable

292Tvariable

368Gvariable

400Tvariable

439Tvariable

460Tvariable

470Avariable

472Cvariable

499Cvariable

526Gvariable

542Tvariable

613Tvariable

622Avariable

AACATTATACTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACATCCCTTAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aproaerema genistaesame genus6.7%Aproaerema polychromellasame genus6.9%Aproaerema suecicellasame genus7.1%Aproaerema sangiellasame genus8.5%Chionodes restiosame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor30

Museum / vouchered3

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 2≤1 km 25≤10 km 3

30 georeferenced

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Research Collection of Kai Berggrenlocation not on record	1

1 institutions · 1 of 3 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Aproaerema captivella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 12.9–20.9

Seasonal swing summer↔winter20.9 °C

Max temp (day)20.7 °C 16.5–24.8

Min temp (night)11.2 °C 6.80–15.6

Precipitation121 mm/mo 115–128

Air humidity59.3 %

Moisture balance11.2 mm/mo -0.2–22.6

Vapour deficit821 Pa 615–1,027

Wind speed2.30 m/s

Cloud cover37.2 % 35.5–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)