Aproaerema genistae

Walsingham, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Aproaerema

At a glance

Occurrence records73

Data sources7

Biological traits0

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Aproaerema genistae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF73 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Syncopacma genistae is a moth of the family Gelechiidae. It is found on the Canary Islands. The wingspan is about 8 mm. The forewings are pale brownish olivaceous at the base, blending to blackish about the middle. The terminal area is sprinkled with brownish, blackish and steel grey scales. The hindwings are leaden grey. The larvae feed within the shoots of Genista canariensis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aproaerema genistae has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

31Amostly conserved

43Gmostly conserved

70Tmostly conserved

100Amostly conserved

106Cmostly conserved

184Gmostly conserved

197Cvariable

205Cmostly conserved

250Cmostly conserved

274Cmostly conserved

287Cmostly conserved

295Amostly conserved

302Amostly conserved

322Amostly conserved

334Gmostly conserved

424Cmostly conserved

427Cmostly conserved

472Tmostly conserved

499Cmostly conserved

535Amostly conserved

553Tmostly conserved

556Gmostly conserved

610Tmostly conserved

631Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGGACATCTCTTAGTTTATTAATTCGAGCTGAATTAGGTAACCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes4

BINs2

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aproaerema captivellasame genus6.7%Aproaerema polychromellasame genus7.2%Aproaerema suecicellasame genus8.4%Aproaerema metadesmasame genus8.5%Aproaerema albifrontellasame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type73 records

Wild obs. + sensor2

Museum / vouchered71

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 69

69 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence71

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Departamento de Zoologia, Universidad de La Lagunalocation not on record	69

1 institutions · 69 of 71 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Aproaerema genistae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 12.7–18.9

Seasonal swing summer↔winter7.70 °C

Max temp (day)18.2 °C 14.9–21.4

Min temp (night)14.1 °C 11.1–17.1

Precipitation31.0 mm/mo 8.50–53.5

Air humidity59.5 % 56.2–62.8

Moisture balance-95.2 mm/mo -149–-41.4

Vapour deficit729 Pa 646–811

Wind speed4.20 m/s 4.00–4.40

Cloud cover33.8 % 29.2–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)