Appias albina

(Boisduval, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Appias

At a glance

Occurrence records1 488

Data sources7

Biological traits0

DNA specimens29

eDNA detections60

Sources7 archives

Databases and archives Appias albina's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 488 records

Environmental DNA1 datasets · 5 countries60 detections

DNA & barcodingBOLD29 specimens

01Narrative

Appias albina, the common albatross, is a small butterfly of the family Pieridae. It is found in south and southeast Asia to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appias albina has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections60

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Tmostly conserved

37Amostly conserved

40Gvariable

76Amostly conserved

139Tmostly conserved

214Gmostly conserved

217Cmostly conserved

337Tvariable

343Cvariable

625Gmostly conserved

631Cvariable

TTTATATTTTATTTTCGGAATTTGATCTGGAATAGTAGGGACATCTCTTAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes10

BIN1

Most divergent pair1.2%

OceaniaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Appias athamasame genus2.6%Appias celestinasame genus7.5%Appias nerosame genus7.6%Saletara liberiasame family9.2%Aglais caschmirensissame order9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_053734 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 488 records

Wild obs. + sensor983

Museum / vouchered505

Range

Area of Occupancy AOO2 780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 218≤1 km 320≤10 km 162>10 km 80

780 georeferenced · 203 without coordinates

Open the mapobservation + sensor983

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 35≤10 km 96>10 km 119

250 georeferenced · 255 without coordinates

Open the institutions mapphysical evidence505

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogorienselocation not on record	232
Cambridge, US	35
New Haven, US	12
Auckland, NZ	12
MZLUlocation not on record	4
Brussels, BE	4
Tomioka, JP	3
Durban Natural Science Museumlocation not on record	2
Helsinki, FI	2
Natural History Museum Rotterdamlocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
RBINS-Scientific Heritagelocation not on record	1

12 institutions · 310 of 505 vouchered records shown · 195 without an institution code

09Environmental DNA60 detections

Where the DNA of Appias albina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.4 °C 27.4–27.4

Seasonal swing summer↔winter12.5 °C

Max temp (day)31.0 °C 28.4–31.0

Min temp (night)23.5 °C 23.5–25.3

Precipitation243 mm/mo 243–260

Air humidity68.3 % 66.3–68.3

Moisture balance90.2 mm/mo 90.2–119

Vapour deficit1,151 Pa 1,151–1,247

Wind speed1.80 m/s 1.80–2.40

Cloud cover63.8 % 63.8–71.5

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Appias albina

At a glance

Sources7 archives

At a glance

Record type1 488 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 488 records