Aglais caschmirensis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Aglais

At a glance

Occurrence records1 779

Data sources6

Biological traits0

DNA specimens16

eDNA detections1

Sources6 archives

Databases and archives Aglais caschmirensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 779 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 779 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aglais caschmirensis, the Indian tortoiseshell, is a species of nymphalid butterfly found in the northern regions of the Indian subcontinent, primarily in the Himalayas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aglais caschmirensis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

2Amostly conserved

30Cmostly conserved

202Tmostly conserved

411Cmostly conserved

560Gmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.76%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aglais ichnusasame genus2.1%Aglais urticaesame genus2.9%Aglais milbertisame genus3.3%Nymphalis californicasame family5.5%Antanartia abyssinicasame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 779 records

Wild obs. + sensor1 671

Museum / vouchered108

Range

Area of Occupancy AOO3 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 432≤1 km 458≤10 km 320>10 km 55

1 265 georeferenced · 406 without coordinates

Open the mapobservation + sensor1 671

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 34≤10 km 20>10 km 48

102 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Tribhuvan Universitylocation not on record	87
MZLUlocation not on record	10
Yokosuka City Museumlocation not on record	3
Brussels, BE	2
Durban Natural Science Museumlocation not on record	1
Tartu, EE	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
National Institute for Biotechnology and Genetic Engineeringlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1

10 institutions · 108 of 108 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aglais caschmirensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter21.5 °C

Max temp (day)29.1 °C

Min temp (night)19.1 °C

Precipitation271 mm/mo

Air humidity58.9 %

Moisture balance121 mm/mo

Vapour deficit1,351 Pa

Wind speed1.00 m/s

Cloud cover18.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aglais caschmirensis

At a glance

Sources6 archives

At a glance

Record type1 779 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 779 records