Appias nero

(Fabricius, 1793) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Appias

At a glance

Occurrence records623

Data sources7

Biological traits0

DNA specimens9

eDNA detections12

Sources7 archives

Databases and archives Appias nero's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility623 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF623 records

Environmental DNA1 datasets · 5 countries12 detections

DNA & barcodingBOLD9 specimens

01Narrative

Appias nero, the orange albatross, is a butterfly of the family Pieridae, that is, the yellows and whites. The species occurs from northern India to the Sunda Islands, the Philippines, Sulawesi and eastwards. Subspecies Appias nero galba is found in India.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Appias nero has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections12

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.64%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 8 variable positions, in barcode order

31Tvariable

73Gvariable

100Amostly conserved

268Avariable

484Avariable

499Cvariable

607Cvariable

634Cvariable

AACTTTATACTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCTCTTAGTTTATTAATTCGAACTGAGTTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Appias celestinasame genus5.6%Appias athamasame genus7.6%Appias albinasame genus7.6%Appias paulinasame genus8.8%Ithomia heraldicasame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_053272 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type623 records

Wild obs. + sensor350

Museum / vouchered273

Range

Area of Occupancy AOO1 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 76≤1 km 152≤10 km 49>10 km 34

311 georeferenced · 39 without coordinates

Open the mapobservation + sensor350

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 2≤1 km 13≤10 km 40>10 km 135

190 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence273

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogorienselocation not on record	37
Auckland, NZ	30
Cambridge, US	23
New Haven, US	6
Zürich, CH	6
Natural History Museum Rotterdamlocation not on record	4
Brussels, BE	4
RBINS-Scientific Heritagelocation not on record	3
Tomioka, JP	2
Yokosuka City Museumlocation not on record	2
MZLUlocation not on record	2
Denver, US	1
Smithsonian Tropical Research Institute, Center for Tropical Forest Science, Khao Chong, Arthropod Laboratorylocation not on record	1
Tartu, EE	1
Natural History Museum of Utahlocation not on record	1
Helsinki, FI	1
Toronto, CA	1
University of Malaya, Museum of Zoologylocation not on record	1

18 institutions · 126 of 273 vouchered records shown · 147 without an institution code

09Environmental DNA12 detections

Where the DNA of Appias nero was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map5 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 17.0–27.7

Seasonal swing summer↔winter2.50 °C

Max temp (day)28.0 °C 20.2–30.7

Min temp (night)21.1 °C 12.9–24.2

Precipitation243 mm/mo 36.4–329

Air humidity69.0 % 66.8–70.0

Moisture balance90.9 mm/mo -12.3–178

Vapour deficit982 Pa 583–1,185

Wind speed1.40 m/s 0.9–1.80

Cloud cover67.6 % 47.7–78.4

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)