Apotomis turbidana

Hübner, 1825 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records6 551

Data sources9

Biological traits2

DNA specimens49

eDNA detections1

Sources9 archives

Databases and archives Apotomis turbidana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 551 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 551 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · NCBI≈720 Mbp

01Narrative

Apotomis turbidana is a moth belonging to the family Tortricidae. The species was first described by Jacob Hübner in 1825. It is native to the Palearctic. The wingspan is 19–23 mm. The ground colour of the forewings is grey and black in the basal part, with irregular white spots. Near the apex there is a wide white cross-band so that the wing tip seems almost pure white. The hindwings are grey-brown. This species is found both in forests and on moors. The larvae feed on Betula spp. The adult butterflies fly in June-July.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis turbidana has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes6

BINs2

Most divergent pair3.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis lineanasame genus2.4%Apotomis demissanasame genus2.6%Apotomis deceptanasame genus2.6%Apotomis capreanasame genus2.6%Apotomis funereasame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Apotomis turbidana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈720 450 266 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Apotomis turbidana0.72 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.3% BUSCO

08Occurrence & distribution

Record type6 551 records

Wild obs. + sensor5 694

Museum / vouchered834

Other23

Range

Area of Occupancy AOO9 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 2 262≤1 km 1 288≤10 km 1 836>10 km 3

5 389 georeferenced · 305 without coordinates

Open the mapobservation + sensor5 694

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 462≤1 km 201≤10 km 74

737 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence834

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	253
NTNU-VMlocation not on record	152
NHMOlocation not on record	88
Tartu, EE	71
Provincia di Livornolocation not on record	38
SLU Artdatabankenlocation not on record	30
Salzburg, AT	25
Rovaniemi, FI	18
Nijmegen, NL	11
Kuopio, FI	10
Stockholm, SE	9
Philadelphia, US	8
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	6
Durban Natural Science Museumlocation not on record	6
South Kensington, GB	4
Metsähallituslocation not on record	3
ZSMlocation not on record	3
University of Kaiserslauternlocation not on record	2
NMBU:MINAlocation not on record	2
BioFokuslocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Brussels, BE	1
MZLUlocation not on record	1
ZMAAlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Tallinn, EE	1

30 institutions · 758 of 834 vouchered records shown · 76 without an institution code

09Environmental DNA1 detections

Where the DNA of Apotomis turbidana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 13.8–13.8

Seasonal swing summer↔winter14.9 °C

Max temp (day)16.2 °C

Min temp (night)10.2 °C

Precipitation84.4 mm/mo

Air humidity59.7 %

Moisture balance-36.1 mm/mo

Vapour deficit637 Pa

Wind speed2.60 m/s

Cloud cover44.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apotomis turbidana

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 551 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 551 records