Apotomis funerea

(Meyrick, 1920) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records200

Data sources7

Biological traits0

DNA specimens35

eDNA detections30

Sources7 archives

Databases and archives Apotomis funerea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 2 countries30 detections

DNA & barcodingBOLD35 specimens

01Narrative

Apotomis funerea is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1920 door Meyrick.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis funerea has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes1

eDNA detections30

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

38Amostly conserved

40Tmostly conserved

46Tmostly conserved

97Cmostly conserved

100Tmostly conserved

101Amostly conserved

103Tmostly conserved

110Amostly conserved

169Cmostly conserved

181Tmostly conserved

196Amostly conserved

206Cmostly conserved

229Amostly conserved

235Tmostly conserved

241Amostly conserved

266Cmostly conserved

349Tmostly conserved

355Tmostly conserved

376Tvariable

391Cmostly conserved

460Tmostly conserved

477Amostly conserved

485Tmostly conserved

500Cmostly conserved

502Amostly conserved

517Gmostly conserved

529Cmostly conserved

562Gmostly conserved

577Gmostly conserved

622Cmostly conserved

628Gmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTCGGTATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes8

BINs2

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis lemniscatanasame genus2.6%Apotomis turbidanasame genus2.7%Apotomis moestanasame genus3.6%Apotomis removanasame genus3.6%Apotomis demissanasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type200 records

Wild obs. + sensor47

Museum / vouchered153

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 41≤1 km 2≤10 km 1

44 georeferenced · 3 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 8≤1 km 56≤10 km 22>10 km 8

94 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence153

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	67
University of Alberta Museums (UAM)location not on record	22
St. Paul, US	14
New Haven, US	11
Cambridge, US	8
Edmonton, CA	7
University of Alaska Museumlocation not on record	5
Vernal, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Royal Saskatchewan Museumlocation not on record	2
San Francisco, US	1
Saint John, CA	1

12 institutions · 146 of 153 vouchered records shown · 7 without an institution code

09Environmental DNA30 detections

Where the DNA of Apotomis funerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 14.3–17.6

Seasonal swing summer↔winter31.2 °C

Max temp (day)20.9 °C 18.3–22.8

Min temp (night)13.1 °C 10.1–14.9

Precipitation99.8 mm/mo 59.3–135

Air humidity59.0 % 55.6–63.4

Moisture balance-10.5 mm/mo -48.5–20.6

Vapour deficit772 Pa 650–887

Wind speed2.30 m/s 1.10–5.60

Cloud cover49.2 % 36.7–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)