Apotomis albeolana

(Zeller, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Apotomis

At a glance

Occurrence records531

Data sources7

Biological traits0

DNA specimens70

eDNA detections70

Sources7 archives

Databases and archives Apotomis albeolana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics70 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF531 records

Environmental DNA1 datasets · 2 countries70 detections

DNA & barcodingBOLD70 specimens

01Narrative

Apotomis albeolana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1875 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding70 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apotomis albeolana has left across the world's sequence archives.

At a glance

DNA specimens70

BINs1

Marker genes1

eDNA detections70

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

4Amostly conserved

5Tmostly conserved

7Gmostly conserved

9Amostly conserved

11Tmostly conserved

12Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

31Tmostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

45Cmostly conserved

46Tmostly conserved

48Cmostly conserved

49Tmostly conserved

54Gmostly conserved

55Amostly conserved

56Tmostly conserved

57Tmostly conserved

59Tmostly conserved

60Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

AACATTGTATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apotomis turbidanasame genus2.9%Apotomis deceptanasame genus3.0%Apotomis capreanasame genus3.0%Apotomis algidanasame genus3.2%Apotomis infidasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type531 records

Wild obs. + sensor436

Museum / vouchered95

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 250≤1 km 41≤10 km 18>10 km 31

340 georeferenced · 96 without coordinates

Open the mapobservation + sensor436

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 5≤10 km 32>10 km 3

40 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	29
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
St. Paul, US	12
Cornell University Insect Collectionlocation not on record	6
Philadelphia, US	4
SOVTlocation not on record	2
Cambridge, US	1
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 71 of 95 vouchered records shown · 24 without an institution code

09Environmental DNA70 detections

Where the DNA of Apotomis albeolana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 8.90–20.0

Seasonal swing summer↔winter30.7 °C

Max temp (day)23.5 °C 13.8–24.6

Min temp (night)13.8 °C 4.30–16.1

Precipitation108 mm/mo 91.9–127

Air humidity59.0 % 56.5–62.8

Moisture balance-22.2 mm/mo -39.0–45.0

Vapour deficit852 Pa 487–955

Wind speed3.10 m/s 2.20–3.50

Cloud cover45.4 % 44.0–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)