Apoica pallens

(Fabricius, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Apoica

At a glance

Occurrence records2 430

Data sources7

Biological traits0

DNA specimens24

eDNA detections8

Sources7 archives

Databases and archives Apoica pallens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 430 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 430 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD24 specimens

01Narrative

The Central American paper wasp (Apoica pallens) is a nocturnal eusocial wasp (family Vespidae). It is famous for its swarm based emigration behavior, and is native to the lowlands of Central and northern South America. This species has developed special night vision adaptations to facilitate their night-time swarming and foraging behavior and has important medicinal properties for the Pankararú people of Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apoica pallens has left across the world's sequence archives.

At a glance

DNA specimens24

BINs6

Marker genes2

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 112 variable positions, in barcode order

1Tmostly conserved

3Tmostly conserved

4Amostly conserved

6Amostly conserved

10Tmostly conserved

12Tmostly conserved

13Amostly conserved

14Tmostly conserved

15Tmostly conserved

16Cmostly conserved

17Gmostly conserved

18Gmostly conserved

21Tmostly conserved

24Gmostly conserved

25Amostly conserved

26Tmostly conserved

27Cmostly conserved

28Cmostly conserved

29Gmostly conserved

30Gmostly conserved

31Tmostly conserved

32Amostly conserved

34Amostly conserved

35Cmostly conserved

36Tmostly conserved

38Gmostly conserved

39Gmostly conserved

43Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Tmostly conserved

50Amostly conserved

51Gmostly conserved

53Tmostly conserved

55Amostly conserved

59Amostly conserved

60Tmostly conserved

61Tmostly conserved

63Gmostly conserved

65Cmostly conserved

66Tmostly conserved

68Gmostly conserved

69Amostly conserved

71Tmostly conserved

72Tmostly conserved

74Gmostly conserved

75Gmostly conserved

77Tmostly conserved

80Cmostly conserved

81Cmostly conserved

84Amostly conserved

87Cmostly conserved

88Tvariable

91Tmostly conserved

92Amostly conserved

95Tmostly conserved

96Tmostly conserved

100Tmostly conserved

103Cvariable

124Tmostly conserved

148Cvariable

194Tmostly conserved

199Tvariable

202Tmostly conserved

203Tmostly conserved

209Cmostly conserved

229Tmostly conserved

247Tmostly conserved

256Cmostly conserved

260Tmostly conserved

268Avariable

319Amostly conserved

331Cmostly conserved

337Cmostly conserved

340Tmostly conserved

355Tvariable

361Tmostly conserved

364Tmostly conserved

370Tvariable

379Cmostly conserved

382Cvariable

398Cmostly conserved

406Cmostly conserved

412Amostly conserved

421Cmostly conserved

424Cmostly conserved

436Tmostly conserved

445Tmostly conserved

454Tmostly conserved

457Amostly conserved

490Cmostly conserved

493Cvariable

520Tmostly conserved

523Cvariable

526Amostly conserved

529Tmostly conserved

535Tmostly conserved

541Tmostly conserved

544Tmostly conserved

553Amostly conserved

554Cmostly conserved

559Amostly conserved

592Cvariable

598Tmostly conserved

601Tmostly conserved

613Tvariable

625Tvariable

631Cmostly conserved

634Tvariable

637Tvariable

638Tmostly conserved

TTTATATTTTTTATTCGGATTATGATCCGGTATACTAGGATCATCTTTAAGATTAATTATTCGACTAGAATTAGGATCACCAAAAACTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.5%

Haplotypes6

BINs5

Most divergent pair5.5%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apoica pallidasame genus7.7%Apoica flavissimasame genus8.6%Agelaia pallipessame family14.5%Agelaia centralissame family14.7%Chartergellus atectussame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 430 records

Wild obs. + sensor1 026

Museum / vouchered1 401

Other3

Range

Area of Occupancy AOO2 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 483≤1 km 235≤10 km 71>10 km 48

837 georeferenced · 189 without coordinates

Open the mapobservation + sensor1 026

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 44≤10 km 37>10 km 1

82 georeferenced · 1 319 without coordinates

Open the institutions mapphysical evidence1 401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	1 227
Wuzhou, CN	56
Provincia di Livornolocation not on record	37
Natural History Museum Rotterdamlocation not on record	36
College Station, US	16
	16
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	6
Philadelphia, US	4
Universidad Nacional de Colombia (UNAL)location not on record	3

9 institutions · 1 401 of 1 401 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Apoica pallens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Seasonal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 20.9–20.9

Seasonal swing summer↔winter1.30 °C

Max temp (day)22.4 °C

Min temp (night)18.5 °C

Precipitation271 mm/mo

Air humidity66.9 %

Moisture balance163 mm/mo

Vapour deficit812 Pa

Wind speed0.8 m/s

Cloud cover25.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apoica pallens

At a glance

Sources7 archives

At a glance

Record type2 430 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 430 records