Agelaia centralis

(Cameron, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Agelaia

At a glance

Occurrence records612

Data sources4

Biological traits0

DNA specimens637

eDNA detections1 071

Sources4 archives

Databases and archives Agelaia centralis's data was compiled from.

GBIFGlobal Biodiversity Information Facility612 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 071 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics637 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF612 records

Environmental DNA1 datasets · 6 countries1 071 detections

DNA & barcodingBOLD637 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding637 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelaia centralis has left across the world's sequence archives.

At a glance

DNA specimens637

BINs3

Marker genes1

eDNA detections1 071

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus633 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

31Tmostly conserved

37Tmostly conserved

76Tmostly conserved

79Tmostly conserved

103Cmostly conserved

217Amostly conserved

220Cmostly conserved

223Cmostly conserved

232Cmostly conserved

277Gvariable

281Cmostly conserved

307Amostly conserved

331Cmostly conserved

344Tmostly conserved

370Tvariable

379Tmostly conserved

397Tmostly conserved

415Cmostly conserved

445Cvariable

526Tmostly conserved

533Cmostly conserved

550Cmostly conserved

578Cmostly conserved

580Tmostly conserved

607Tmostly conserved

613Cmostly conserved

616Tmostly conserved

619Cmostly conserved

622Amostly conserved

637Cmostly conserved

643Tmostly conserved

TTTATATTTTATTTTTGGATTATGATCAGGTATACTTGGAACATCTTTAAGATTTATTATCCGATTAGAATTAGGTTTTCCAGGAACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes31

BINs3

Most divergent pair5.2%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelaia pallipessame genus3.4%Agelaia melanopygasame genus5.7%Agelaia yepocapasame genus6.1%Agelaia areatasame genus10.1%Agelaia cajennensissame genus13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type612 records

Wild obs. + sensor315

Museum / vouchered294

Other3

Range

Area of Occupancy AOO1 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 145≤1 km 70≤10 km 33>10 km 14

262 georeferenced · 53 without coordinates

Open the mapobservation + sensor315

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 10

10 georeferenced · 284 without coordinates

Open the institutions mapphysical evidence294

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	208
Centre for Biodiversity Genomicslocation not on record	63
Provincia di Livornolocation not on record	10
Universidad del Atlántico (UniAtlantico)location not on record	7
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	4
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2

6 institutions · 294 of 294 vouchered records shown

09Environmental DNA1 071 detections

Where the DNA of Agelaia centralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 071

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 071 detections have coordinates

Open the map6 countries0

ForestSteep, forest, low but mostly closed canopy,…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.9. Subtropical/Tropic…Steep, forest, low but mostly closed canopy,…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 11.7–25.6

Seasonal swing summer↔winter2.40 °C

Max temp (day)24.6 °C 15.5–28.7

Min temp (night)17.0 °C 8.20–23.8

Precipitation233 mm/mo 58.1–548

Air humidity70.5 % 63.0–73.9

Moisture balance130 mm/mo -91.6–456

Vapour deficit693 Pa 384–1,157

Wind speed1.50 m/s 1.20–4.20

Cloud cover33.8 % 15.2–64.8

CHELSA 1981–2010, ~9 km grid, at location & month of 1 070 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)