Agelaia pallipes

(Olivier, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Agelaia

At a glance

Occurrence records550

Data sources7

Biological traits0

DNA specimens39

eDNA detections4

Sources7 archives

Databases and archives Agelaia pallipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility550 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF550 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD39 specimens

01Narrative

Agelaia pallipes is a species of social paper wasp found from Costa Rica to Argentina and Paraguay. A. pallipes is ground-nesting and is one of the most aggressive wasps in South America. This species is a predator of other insects, including flies, moths, and ground crickets, as well as baby birds.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agelaia pallipes has left across the world's sequence archives.

At a glance

DNA specimens39

BINs3

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

76Amostly conserved

151Tmostly conserved

319Gmostly conserved

346Amostly conserved

349Gmostly conserved

559Tmostly conserved

595Cmostly conserved

602Tmostly conserved

631Cmostly conserved

TTTATATTTTATTTTTGGATTATGATCAGGTATACTTGGAACATCTTTAAGATTTATTATCCGATTAGAATTAGGATTTCCAGGAACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BINs3

Most divergent pair2.3%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agelaia centralissame genus3.4%Agelaia melanopygasame genus6.0%Agelaia yepocapasame genus6.0%Agelaia areatasame genus8.6%Parachartergus apicalissame family13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type550 records

Wild obs. + sensor330

Museum / vouchered205

Other15

Range

Area of Occupancy AOO1 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 115≤1 km 47≤10 km 74>10 km 18

254 georeferenced · 76 without coordinates

Open the mapobservation + sensor330

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 6≤10 km 30

38 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	145
Natural History Museum Rotterdamlocation not on record	30
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	18
Provincia di Livornolocation not on record	5
Champaign, US	3
Philadelphia, US	2
OSUClocation not on record	1
Wuzhou, CN	1

8 institutions · 205 of 205 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Agelaia pallipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)