Apogonichthyoides atripes

(Ogilby, 1916) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogonichthyoides

At a glance

Occurrence records1 425

Data sources7

Biological traits6

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Apogonichthyoides atripes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility653 records↗

OBISOcean Biodiversity Information System772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 425 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Apogonichthyoides atripes is een straalvinnige vissensoort uit de familie van de kardinaalbaarzen (Apogonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1916 door Ogilby.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max30 m

Depth min6 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogonichthyoides atripes has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P677 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes1

BINs2

Where individuals differ — all 24 variable positions, in barcode order

3Cvariable

105Cvariable

177Avariable

213Cvariable

222Tvariable

246Tvariable

252Avariable

354Avariable

369Cvariable

378Gvariable

396Avariable

480Cvariable

488Cvariable

504Cvariable

507Tvariable

510Avariable

516Gvariable

526Cvariable

543Gvariable

585Avariable

591Cvariable

600Avariable

621Tvariable

627Tvariable

GACATTGGCACCCTCTACCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGAACAGCCCTCAGCCTACTAATCCGAGCTGAGCTTAGCCAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogonichthyoides nigersame genus6.6%Apogonichthyoides nigripinnissame genus9.4%Apogonichthyoides pharaonissame genus10.0%Apogonichthyoides taeniatussame genus11.8%Apogonichthyoides umbratilissame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 425 records

Wild obs. + sensor885

Museum / vouchered539

Other1

Range

Area of Occupancy AOO1 784 km²

Depth

0–200 m sunlit485

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 41.1 m · max 93 m · 485 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 110≤1 km 770

880 georeferenced · 5 without coordinates

Open the mapobservation + sensor885

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 38≤1 km 138≤10 km 121>10 km 60

357 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence539

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	74
Sydney, AU	54
Natick, US	42
DEWlocation not on record	22
Museum and Art Gallery of the Northern Territorylocation not on record	9
Museums Victorialocation not on record	3
CSIRO, Australian National Fish Collectionlocation not on record	1
Chicago, US	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

9 institutions · 207 of 539 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Apogonichthyoides atripes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 18.6–25.1

Seasonal swing summer↔winter7.00 °C

Max temp (day)25.8 °C 20.0–26.0

Min temp (night)24.0 °C 17.1–24.3

Precipitation0.4 mm/mo 0.3–51.8

Air humidity58.1 % 56.2–60.4

Vapour deficit1,230 Pa 931–1,319

Cloud cover18.4 % 13.5–19.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apogonichthyoides atripes

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type1 425 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 425 records