Apogonichthyoides pharaonis

(Bellotti, 1874) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Apogonidae/Apogonichthyoides

At a glance

Occurrence records502

Data sources9

Biological traits7

DNA specimens9

eDNA detections9

Sources9 archives

Databases and archives Apogonichthyoides pharaonis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

OBISOcean Biodiversity Information System240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS502 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Apogonichthyoides pharaonis, the Pharaoh cardinalfish, is a species of cardinalfish from the family Apogonidae which is found the western Indian Ocean and Red Sea. It is one of a group of species which have colonised the eastern Mediterranean Sea from the Red Sea via the Suez Canal, a process known as Lessepsian migration.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length9.5 cm

Body mass20 g

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max2 m

Depth min0 m

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apogonichthyoides pharaonis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

3Amostly conserved

16Gmostly conserved

17Cmostly conserved

39Cmostly conserved

330Cvariable

369Avariable

558Tvariable

624Cvariable

GTATTTGGTGCTTGAGCCGGAATAGTGGGAACAGCCCTCAGCCTACTCATCCGAGCTGAGCTTAGCCAGCCTGGGGCCCTTCTCGGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes3

BIN1

Most divergent pair1.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogonichthyoides nigripinnissame genus9.0%Apogonichthyoides atripessame genus10.0%Apogonichthyoides nigersame genus10.8%Apogonichthyoides taeniatussame genus12.6%Ostorhinchus ishigakiensissame family15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type502 records

Wild obs. + sensor468

Museum / vouchered33

Other1

Origin

Native6

Introduced11

Range

Area of Occupancy AOO528 km²

Depth

0–200 m sunlit214

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 40 m · max 200 m · 214 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 9≤10 km 6>10 km 1

21 georeferenced · 447 without coordinates

Open the mapobservation + sensor468

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 3>10 km 3

9 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SMNHTAUlocation not on record	6
South African Institute for Aquatic Biodiversitylocation not on record	4
Istanbul University, Science Faculty, Hydrobiology Museumlocation not on record	2
Omar Al-Moukhtar University, El Bayda, Libyalocation not on record	1
Washington, US	1

5 institutions · 14 of 33 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Apogonichthyoides pharaonis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

Sandy BottomMarine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 13.4–23.8

Seasonal swing summer↔winter12.4 °C

Max temp (day)21.7 °C 16.4–27.7

Min temp (night)15.9 °C 9.80–20.9

Precipitation42.3 mm/mo 1.20–177

Air humidity57.3 % 52.7–62.2

Moisture balance107 mm/mo

Vapour deficit829 Pa 688–1,247

Wind speed2.70 m/s

Cloud cover34.3 % 10.8–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)