Aplysina fistularis

(Pallas, 1766) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Verongiida/Aplysinidae/Aplysina

At a glance

Occurrence records2 325

Data sources10

Biological traits6

DNA specimens10

eDNA detections7

Sources10 archives

Databases and archives Aplysina fistularis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 143 records↗

OBISOcean Biodiversity Information System182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS101 compounds

Occurrence & distributionGBIF · OBIS2 325 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aplysina fistularis, also known as the yellow tube sponge, is a species of sea sponge in the order Verongiida. Aplysina fistularis is a golden or orange-brown color with a conulose surface. The animal is abundant in the Caribbean, where it is commonly found in reefs of open water areas. This sponge was first described by the Prussian zoologist Peter Simon Pallas in 1766.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length20 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max60 m

Depth min0 m

03Chemical composition101 compounds

Compounds documented for Aplysina fistularis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Unsaturated fatty acids14

Fatty aldehydes9

Branched fatty acids $ Hydroxy fatty acids8

Hydroxy fatty acids8

Wax monoesters7

Documented compounds101 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Pinene	present	NPASS
(-)-Borneol	present	NPASS
(-)-Camphene	present	NPASS
(-)-Clerosterol	present	LOTUS
(24S)-24-Methyl-25-dehydrocholesterol	present	LOTUS
(5R,10S)-7,9-dibromo-N-[4-[[(5S,10R)-7,9-dibromo-10-hydroxy-8-methoxy-4-oxa-3-azaspiro[4.5]deca-2,6,8-triene-2-carbonyl]amino]butyl]-10-hydroxy-8-methoxy-4-oxa-3-azaspiro[4.5]deca-2,6,8-triene-2-carboxamide	present	LOTUS
(5R,6S)-7,9-dibromo-N-[5-[[(5S,6R)-7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl]amino]-4-oxopentyl]-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carboxamide	present	LOTUS
(5S)-5-[[2,6-dibromo-4-[(5S)-2-oxo-1,3-oxazolidin-5-yl]phenoxy]methyl]-1,3-oxazolidin-2-one	present	LOTUS
(5S,10R)-7,9-dibromo-N-[4-[[(5S,10R)-7,9-dibromo-10-hydroxy-8-methoxy-4-oxa-3-azaspiro[4.5]deca-2,6,8-triene-2-carbonyl]amino]-3-oxo-butyl]-10-hydroxy-8-methoxy-4-oxa-3-azaspiro[4.5]deca-2,6,8-triene-2-carboxamide	present	LOTUS
(5S,5'S,10S,10'R)-N,N'-(1,5-Pentanediyl)bis[7,9-dibromo-10-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,6,8-triene-3-carboxamide]	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysina fistularis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes3

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Diversity (π)8.6%

Haplotypes1

BIN1

Where individuals differ — all 80 variable positions, in barcode order

3Avariable

4Gvariable

5Gvariable

7Gvariable

8Avariable

9Avariable

10Avariable

11Avariable

12Avariable

16Avariable

18Gvariable

21Gvariable

22Cvariable

170Avariable

554Tmostly conserved

555Cmostly conserved

558Amostly conserved

559Amostly conserved

560Cmostly conserved

562Tmostly conserved

563Tmostly conserved

564Gmostly conserved

565Amostly conserved

566Gmostly conserved

567Cmostly conserved

568Cmostly conserved

569Tmostly conserved

570Gmostly conserved

571Gmostly conserved

574Cmostly conserved

575Amostly conserved

577Amostly conserved

578Tmostly conserved

579Amostly conserved

581Cmostly conserved

582Tmostly conserved

583Cmostly conserved

585Amostly conserved

586Gmostly conserved

587Tmostly conserved

588Cmostly conserved

589Tmostly conserved

590Amostly conserved

591Amostly conserved

593Tmostly conserved

595Amostly conserved

596Cmostly conserved

598Tmostly conserved

599Amostly conserved

600Cmostly conserved

603Amostly conserved

604Amostly conserved

605Tmostly conserved

606Gmostly conserved

607Cmostly conserved

610Tmostly conserved

612Cmostly conserved

613Cmostly conserved

615Amostly conserved

616Tmostly conserved

617Cmostly conserved

620Avariable

621Avariable

622Cvariable

624Cvariable

627Avariable

628Avariable

631Avariable

632Avariable

633Avariable

635Avariable

636Avariable

637Avariable

638Avariable

644Avariable

645Avariable

648Avariable

649Avariable

651Avariable

652Gvariable

AAAGGTGAAAAAAAAATGGGGCCCCCCCGCCTGCTGGATCAAAAAATGTTGTGTTAAAATTTCTATCGGTTAAAAGCATAGTAATTGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Verongula rigidasame family8.9%Aiolochroia crassasame family9.2%Suberea ianthelliformissame order11.1%Pseudoceratina purpureasame order12.4%Ianthella bastasame order13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type2 325 records

Wild obs. + sensor1 976

Museum / vouchered347

Cultivated / captive2

Range

Area of Occupancy AOO2 404 km²

Depth

0–200 m sunlit163

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18 m · max 121.5 m · 163 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 533≤1 km 315≤10 km 88>10 km 64

1 000 georeferenced · 976 without coordinates

Open the mapobservation + sensor1 976

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 17≤1 km 2≤10 km 7>10 km 2

28 georeferenced · 319 without coordinates

Open the institutions mapphysical evidence347

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Región Poza Rica-Tuxpanlocation not on record	144
Washington, US	44
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	43
New Haven, US	8
Moscow State Universitylocation not on record	6
Masindi, UG	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Cambridge, US	3
UM-RSMASlocation not on record	2
Comision Colombiana del Oceanolocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
CASlocation not on record	1
WoRMS Editorial Boardlocation not on record	1
Museo de Historia Natural, Universidad Autónoma de Baja California Surlocation not on record	1

15 institutions · 264 of 347 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Aplysina fistularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 26.5–26.5

Seasonal swing summer↔winter1.20 °C

Max temp (day)27.3 °C

Min temp (night)25.8 °C

Precipitation174 mm/mo

Air humidity64.3 %

Vapour deficit1,236 Pa

Cloud cover26.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysina fistularis

At a glance

Sources10 archives

Size & morphology1

Habitat & environment3

Other traits2

Compound class profile5 classes

Documented compounds101 total

At a glance

Record type2 325 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 325 records