Aplidium turbinatum

(Savigny, 1816) · species

image placeholder — illustration coming later

Animalia/Chordata/Ascidiacea/Aplousobranchia/Polyclinidae/Aplidium

At a glance

Occurrence records3 505

Data sources11

Biological traits2

DNA specimens7

eDNA detections2

Sources11 archives

Databases and archives Aplidium turbinatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 665 records↗

OBISOcean Biodiversity Information System1 840 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF · OBIS3 505 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈605 Mbp

01Narrative

Aplidium turbinatum is een zakpijpensoort uit de familie van de Polyclinidae. De wetenschappelijke naam van de soort werd in 1816 voor het eerst geldig gepubliceerd door Marie Jules César Savigny.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition26 compounds

Compounds documented for Aplidium turbinatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty alcohols3

Flavanones2

Simple phenolic acids2

Hydrocarbons2

Cinnamic acids and derivatives $ Simple phenolic acids1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(1-Amino-2,6,7,10,11,14,27-heptahydroxy-1-oxodotriacontan-15-yl) hydrogen sulfate	present	LOTUS
(6Z,9Z,12Z,15Z)-henicosa-6,9,12,15-tetraene	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
5-Hydroxy-7-methoxychromone	present	NPASS
7-(beta-D-Glucopyranosyloxy)-5-hydroxy-6-methoxy-2H-1-benzopyran-2-one	present	NPASS
[(2R,6R,10S)-6,10-dimethyl-2-(4-methylpentyl)-11-sulfooxyundecyl] hydrogen sulfate	present	LOTUS
[(6R,10R,14S)-2,10,14-trimethyl-17-sulfooxyheptadecan-6-yl] hydrogen sulfate	present	LOTUS
beta-Sitosterol	present	NPASS
cis-3,6,9,12,15-Heneicosapentaene	present	NPASS
Communin A	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplidium turbinatum has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 2 variable positions, in barcode order

111Avariable

231Gvariable

CGATTGAATAATATAAGTTTTTGGTTATTACCCCCTTCATTGTTTTTATTATGTTTATCTATTTTTATTGGAGATAGAGTAGGAACTAGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Morchellium argussame family14.8%Aplidium proliferumsame genus15.8%Aplidium accarensesame genus16.3%Aplidium eleganssame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aplidium turbinatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈605 489 456 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aplidium turbinatum0.61 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.1% BUSCO

08Occurrence & distribution

Record type3 505 records

Wild obs. + sensor1 590

Museum / vouchered1 663

Other252

Range

Area of Occupancy AOO3 256 km²

Depth

0–200 m sunlit789

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 11.1 m · max 73 m · 789 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 386≤1 km 34≤10 km 10

1 430 georeferenced · 160 without coordinates

Open the mapobservation + sensor1 590

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 23≤1 km 3>10 km 1

27 georeferenced · 1 636 without coordinates

Open the institutions mapphysical evidence1 663

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	19
PNHSlocation not on record	16
NHMOlocation not on record	7
NTNU-VMlocation not on record	4
Senckenberg Research Institute and Natural History Museumlocation not on record	3
University of Oslo, Natural History Museumlocation not on record	3
Citadel Hill, GB	2
Gothenburg, SE	1
Santa Barbara Museum of Natural Historylocation not on record	1

9 institutions · 56 of 1 663 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Aplidium turbinatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C 8.70–10.3

Seasonal swing summer↔winter8.70 °C

Max temp (day)11.1 °C 10.1–12.1

Min temp (night)7.20 °C 6.50–7.90

Precipitation65.5 mm/mo 63.4–67.5

Air humidity62.4 % 62.3–62.5

Vapour deficit445 Pa 422–468

Cloud cover47.5 % 46.2–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplidium turbinatum

At a glance

Sources11 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds26 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 505 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 505 records