Aplidium elegans

(Giard, 1872) · species

image placeholder — illustration coming later

Animalia/Chordata/Ascidiacea/Aplousobranchia/Polyclinidae/Aplidium

At a glance

Occurrence records2 445

Data sources11

Biological traits2

DNA specimens8

eDNA detections4

Sources11 archives

Databases and archives Aplidium elegans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 716 records↗

OBISOcean Biodiversity Information System729 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF · OBIS2 445 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · NCBI≈560 Mbp

01Narrative

Aplidium elegans (sea-strawberry) is a species of colonial sea squirt, a tunicate that is a benthic invertebrate in the family Polyclinidae and class Ascidiacea.Bay-Nouailhat A., September 2005, Description of Aplidium elegans, Available on line at http://www.european-marine-life.org/32/aplidium-elegans.php, consulted on 02 March 2019. It is native to shallow waters in the Atlantic Ocean and Mediterranean Sea. It is also found in between France and the United Kingdom.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition3 compounds

Compounds documented for Aplidium elegans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
FHWBMPKGHCEEEC-FVYAUOJASA-N	present	NPASS
NHENZQJUJORFFG-NSHDSACASA-N	present	NPASS
PVLYGYSHWHOEFU-RBUKOAKNSA-N	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplidium elegans has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P856 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.12%

Where individuals differ — all 2 variable positions, in barcode order

334Avariable

843Cvariable

TATTGGTACTTTATATTTTATTTTTAGAATGTGGTCTGCTTTTTTAGGAACTTCTTTGAGTTTATTGATTCGTTTGGAGTTGTCTCAAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplidium proliferumsame genus14.8%Aplidium accarensesame genus15.0%Aplidium turbinatumsame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aplidium elegans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈559 736 880 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aplidium elegans0.56 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 445 records

Wild obs. + sensor1 589

Museum / vouchered623

Other233

Origin

Native24

Range

Area of Occupancy AOO2 500 km²

Depth

0–200 m sunlit585

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 21.1 m · max 93 m · 585 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 861≤1 km 189≤10 km 34>10 km 2

1 086 georeferenced · 503 without coordinates

Open the mapobservation + sensor1 589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 12≤10 km 3

15 georeferenced · 608 without coordinates

Open the institutions mapphysical evidence623

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	10
Paris, FR	8
PNHSlocation not on record	8
UCA - SOCIBlocation not on record	4
Citadel Hill, GB	2
Natural History Museum, Londonlocation not on record	2
Frankfurt am Main	2
South Kensington, GB	2

8 institutions · 38 of 623 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Aplidium elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–24.8

Seasonal swing summer↔winter14.8 °C

Max temp (day)28.5 °C

Min temp (night)21.0 °C

Precipitation8.50 mm/mo

Air humidity54.8 %

Moisture balance-174 mm/mo

Vapour deficit1,414 Pa

Wind speed3.20 m/s

Cloud cover35.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplidium elegans

At a glance

Sources11 archives

Habitat & environment2

Documented compounds3 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 445 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 445 records