Aplidium accarense

(Millar, 1953) · species

image placeholder — illustration coming later

Animalia/Chordata/Ascidiacea/Aplousobranchia/Polyclinidae/Aplidium

At a glance

Occurrence records94

Data sources7

Biological traits2

DNA specimens11

eDNA detections2

Sources7 archives

Databases and archives Aplidium accarense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

OBISOcean Biodiversity Information System30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS94 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingBOLD11 specimens

01Narrative

Aplidium accarense is een zakpijpensoort uit de familie van de Polyclinidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1953 door Millar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplidium accarense has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

16Tmostly conserved

26Tmostly conserved

138Tmostly conserved

257Tmostly conserved

298Cmostly conserved

340Gmostly conserved

372Tmostly conserved

381Tmostly conserved

479Tmostly conserved

486Tmostly conserved

584Gmostly conserved

597Tmostly conserved

620Tmostly conserved

624Tmostly conserved

625Amostly conserved

ACTTCTCTTAGTATATTAGTTCGGTTGGAGTTATCACAAACTAGACAAATTATTAGAAATGGTCAAATTTATAATGTAGTTGTAACTGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes3

BIN1

Most divergent pair2.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplidium eleganssame genus15.0%Aplidium proliferumsame genus17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor43

Museum / vouchered50

Other1

Range

Area of Occupancy AOO128 km²

Depth

0–200 m sunlit17

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.6 m · max 16 m · 17 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 1

8 georeferenced · 35 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UFPRlocation not on record	37
UNICAMPlocation not on record	2
ARMS-MBONlocation not on record	1

3 institutions · 40 of 50 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Aplidium accarense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 16.1–16.1

Seasonal swing summer↔winter8.60 °C

Max temp (day)17.5 °C

Min temp (night)14.8 °C

Precipitation55.0 mm/mo

Air humidity66.1 %

Moisture balance-82.0 mm/mo

Vapour deficit620 Pa

Wind speed5.30 m/s

Cloud cover41.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)