Apiomorpha pomaphora

Gullan & Jones, 1989 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Eriococcidae/Apiomorpha

At a glance

Occurrence records12

Data sources5

Biological traits0

DNA specimens23

eDNA detections23

Sources5 archives

Databases and archives Apiomorpha pomaphora's data was compiled from.

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 0 countries23 detections

DNA & barcodingBOLD23 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apiomorpha pomaphora has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes2

eDNA detections23

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P530 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.43%

Haplotypes2

BINs2

Most divergent pair1.3%

Where individuals differ — all 7 variable positions, in barcode order

214Amostly conserved

273Tmostly conserved

291Cmostly conserved

384Cmostly conserved

417Tmostly conserved

429Cmostly conserved

450Cmostly conserved

AATAACTTCAATAACAACTCCATCTATTATATAATAATTACTATTCATGCTTTCATAATAATTTTCTTTATAACTATACCAATCATTATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apiomorpha jucundacrispisame genus14.5%Apiomorpha hillisame genus14.9%Apiomorpha gongylocarpaesame genus15.7%Apiomorpha variabilissame genus17.2%Apiomorpha ovicolasame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type12 records

Wild obs. + sensor6

Museum / vouchered6

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 4 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Western Australian Museumlocation not on record	6

1 institutions · 6 of 6 vouchered records shown

09Environmental DNA23 detections

Where the DNA of Apiomorpha pomaphora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)