Apiomorpha variabilis

(Froggatt, 1893) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Eriococcidae/Apiomorpha

At a glance

Occurrence records58

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Apiomorpha variabilis's data was compiled from.

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 0 countries13 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT · TreeOfSex2n = 80

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apiomorpha variabilis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P551 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

7Tvariable

55Tmostly conserved

301Cvariable

304Tmostly conserved

310Cmostly conserved

AAATAATAATTTTAATAATAACTCAATTTATTATATAATAATTACTATTCATGCTTTTATAATAATTTTTTTTATAACTATACCTATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes3

BIN1

Most divergent pair0.73%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apiomorpha ovicolasame genus13.2%Apiomorpha sessilissame genus14.0%Apiomorpha nookarasame genus15.1%Apiomorpha gongylocarpaesame genus17.0%Apiomorpha annulatasame genus17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Apiomorpha variabilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Chromosome records80–802n range80median80mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 802×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type58 records

Wild obs. + sensor54

Museum / vouchered4

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 26≤1 km 8>10 km 4

38 georeferenced · 16 without coordinates

Open the mapobservation + sensor54

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	3
Natick, US	1

2 institutions · 4 of 4 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Apiomorpha variabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)