Apiomorpha ovicola

(Schrader, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Eriococcidae/Apiomorpha

At a glance

Occurrence records74

Data sources7

Biological traits0

DNA specimens155

eDNA detections4

Sources7 archives

Databases and archives Apiomorpha ovicola's data was compiled from.

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics155 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD155 specimens

Genome at a glanceGoaT · TreeOfSex2n = 62

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding155 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apiomorpha ovicola has left across the world's sequence archives.

At a glance

DNA specimens155

BINs16

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P551 bp consensus152 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 101 variable positions, in barcode order

4Tmostly conserved

10Cmostly conserved

16Cvariable

22Tmostly conserved

28Cvariable

31Cmostly conserved

36Cmostly conserved

46Tmostly conserved

58Cvariable

79Tmostly conserved

88Tmostly conserved

91Tvariable

94Tmostly conserved

100Amostly conserved

103Tmostly conserved

109Cvariable

121Amostly conserved

130Tmostly conserved

139Tvariable

142Tmostly conserved

143Tmostly conserved

148Tmostly conserved

151Cvariable

154Tmostly conserved

163Cvariable

166Tmostly conserved

167Cmostly conserved

172Amostly conserved

175Tvariable

179Tmostly conserved

182Tmostly conserved

187Cmostly conserved

190Avariable

202Cmostly conserved

208Tvariable

209Cmostly conserved

214Avariable

220Avariable

221Tmostly conserved

226Tmostly conserved

238Tmostly conserved

250Tmostly conserved

253Amostly conserved

259Tmostly conserved

262Amostly conserved

263Cmostly conserved

266Gmostly conserved

277Tmostly conserved

281Tmostly conserved

286Amostly conserved

292Tmostly conserved

293Tvariable

301Tmostly conserved

304Cmostly conserved

307Tmostly conserved

310Tmostly conserved

313Cvariable

314Tmostly conserved

319Tvariable

322Amostly conserved

335Cmostly conserved

343Tmostly conserved

355Tmostly conserved

376Tvariable

379Tmostly conserved

381Amostly conserved

382Cmostly conserved

386Cvariable

394Cvariable

400Cvariable

403Cvariable

404Cmostly conserved

406Amostly conserved

415Amostly conserved

427Cvariable

436Tmostly conserved

437Tmostly conserved

440Tmostly conserved

445Cmostly conserved

446Cmostly conserved

448Avariable

457Avariable

461Tmostly conserved

469Avariable

472Tmostly conserved

475Cvariable

484Cvariable

493Tvariable

496Avariable

499Tvariable

502Tvariable

517Tmostly conserved

520Tvariable

523Cvariable

524Tmostly conserved

529Cvariable

532Cvariable

535Cvariable

538Tmostly conserved

544Cvariable

550Tvariable

AAATAATAACTTTAACAATAATTCAATCTACTATACAATAATTACTATCCATGCTTTCATAATAATTTTTTTTATAACTATACCAATTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 54 variants.

Diversity (π)6.4%

Haplotypes54

BINs14

Most divergent pair12.2%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apiomorpha nookarasame genus7.1%Apiomorpha sessilissame genus12.5%Apiomorpha annulatasame genus12.9%Apiomorpha variabilissame genus13.2%Apiomorpha jucundacrispisame genus17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Apiomorpha ovicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome records62–622n range62median62mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 622×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type74 records

Wild obs. + sensor17

Museum / vouchered57

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 9>10 km 1

10 georeferenced · 7 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 30≤1 km 3

33 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSW Dept of Planning, Industry and Environmentlocation not on record	33
DPIlocation not on record	20
Natick, US	1

3 institutions · 54 of 57 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Apiomorpha ovicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter14.5 °C

Max temp (day)29.8 °C

Min temp (night)16.7 °C

Precipitation25.1 mm/mo

Air humidity46.5 %

Moisture balance-159 mm/mo

Vapour deficit1,530 Pa

Wind speed3.20 m/s

Cloud cover18.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)