Aphrophora fulva

Doering, 1941 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphrophoridae/Aphrophora

At a glance

Occurrence records1

Data sources6

Biological traits0

DNA specimens41

eDNA detections40

Sources6 archives

Databases and archives Aphrophora fulva's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD41 specimens

01Narrative

Aphrophora fulva is een halfvleugelig insect uit de familie Aphrophoridae. De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1941 door Doering.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrophora fulva has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes1

eDNA detections40

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

562Amostly conserved

650Tmostly conserved

TTTATATTTTCTATTTGGTATTTGATCAGGAATAATTGGGACAACTTTAAGATTATTAATTCGGGTTGAATTGGGTCAACCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes4

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrophora permutatasame genus2.3%Aphrophora maculosasame genus2.3%Aphrophora canadensissame genus5.0%Aphrophora princepssame genus5.7%Aphrophora corticeasame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montgomery, US	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA40 detections

Where the DNA of Aphrophora fulva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

4. Native Grassland1. Forest & Woodland | 1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 13.5–20.8

Seasonal swing summer↔winter25.5 °C

Max temp (day)25.7 °C 20.2–28.8

Min temp (night)10.0 °C 6.50–14.5

Precipitation39.3 mm/mo 18.6–72.3

Air humidity45.0 % 44.4–51.5

Moisture balance-122 mm/mo -148–-51.0

Vapour deficit1,161 Pa 768–1,319

Wind speed2.80 m/s 2.40–3.20

Cloud cover29.5 % 26.5–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)