Aphrophora canadensis

Walley, 1928 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphrophoridae/Aphrophora

At a glance

Occurrence records1

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Aphrophora canadensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Philaronia canadensis is a species of spittlebug in the family Aphrophoridae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrophora canadensis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.63%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

98Gvariable

99Gvariable

101Gvariable

124Tvariable

172Tvariable

177Tvariable

TACTTTATATTTTTTATTTGGTATTTGGTCAGGAATAATTGGGACAACATTAAGATTATTAATTCGGGTTGAATTGGGTCAACCTGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrophora princepssame genus4.3%Aphrophora permutatasame genus4.9%Aphrophora maculosasame genus4.9%Aphrophora fulvasame genus5.0%Aphrophora corticeasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the institutions mapphysical evidence1

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aphrophora canadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.7–15.5

Seasonal swing summer↔winter22.1 °C

Max temp (day)18.4 °C 18.4–18.7

Min temp (night)7.10 °C 7.10–12.7

Precipitation80.7 mm/mo 19.2–80.7

Air humidity53.8 % 53.8–61.6

Moisture balance-37.0 mm/mo

Vapour deficit679 Pa 675–679

Wind speed2.60 m/s

Cloud cover41.1 % 31.1–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)